Labshake search
Citations for Merck :
551 - 600 of 5076 citations for 6H Dibenzo b d pyran 3 pentanaminium 6a 7 10 10a tetrahydro 1 hydroxy N N N 6 6 9 hexamethyl 6aR trans 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... formoterol fumarate dihydrate (10 mg·kg-1, Merck) or propranolol hydrochloride (20 mg·kg-1 for the first five days and 10 mg·kg-1 from day six until euthanasia ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.48 mM MgSO4 x 7 H2O (Merck, 1058860500), 1.2 mM KCl (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... anti-HA (HA-7, H3663, lot 066M4837V, Merck) 1/1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... Ferrets were euthanized by intravenous injection of 1 ml of Beuthanasia-D diluted 1:1 with DI water (Merck, Madison, NJ). For determination of ferret ID50 ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies (FUS 1:100 Santa Cruz Biotech sc-47711; ISL1 1:500 Abcam ab109517; OLIG2 1:100 R&D Systems AF2418; NFM 1:1000 Merck MAB1621) were added in 1% BSA and incubated at 4degC overnight ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the diet for both the transgenic and wild-type strains was supplemented with CuSO4•5H2O (1 mM, Merck, CAS-no: 7758-99-9). Flies were reared in a controlled environment room at 25.0 °C ...
-
bioRxiv - Biophysics 2020Quote: ... RNAse A (1 mg ml−1, 10 min, 21°C, Merck) or DNAse (200 Units well−1 ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Microbiology 2020Quote: ... Phases A and B were water (MilliQ, Merck) and acetonitrile (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... using RP select B 125-4 Column (Merck). The chromatography was carried out at a flow rate of 1.5ml/min starting with a mobile phase of 80% methanol and 20% H2O for 3 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... on gelatin-coated plates (Merck, #ES-006-B). Such plates were used for Figures 3C and S5B.
-
bioRxiv - Neuroscience 2023Quote: ... polymixin B solution (81271, Merck Life Science S.L.) and dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2022Quote: ... and stop solution (0.16 M Sulfuric Acid (Merck cat. No. 7664-93-9)) were prepared in-house ...
-
bioRxiv - Systems Biology 2023Quote: Caspase-9 activity was measured in liver lysate according to manufacturer’s protocol (Merck Caspase-9 Colorimetric Activity Assay Kit APT139 ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 µM trans- Epoxysuccinyl-L-leucylamido(4-guanidino)butan (E64, Sigma-Aldrich, Merck, Taufkirchen, Germany) was added ...
-
bioRxiv - Microbiology 2021Quote: ... actinomycin D (A1410, Merck), and cycloheximide (037-20991 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cytochalasin D (Merck, #C8273), Nocodazole (Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.6% D-glucose (Merck), 1 mM sodium pyruvate (Nacalai Tesque ...
-
bioRxiv - Physiology 2020Quote: D-Glucose (Merck, 8342) was dissolved in ddH2O and supplemented to the NGM after autoclaving and UVB killed E ...
-
bioRxiv - Cell Biology 2023Quote: ... dihydroxytestosterone (Merck, #D-073) or EtOH as solvent control ...
-
bioRxiv - Cell Biology 2023Quote: Cytochalasin D (Merck C2618) was used at concentrations ranging from 100nM to 10 µM ...
-
bioRxiv - Developmental Biology 2022Quote: Ciliobrevin D (Merck, 250401) 5 mM dimethyl sulfoxide (DMSO ...
-
bioRxiv - Bioengineering 2023Quote: ... Cytochalasin D (C8273, Merck); CA3 (CIL56 ...
-
bioRxiv - Cell Biology 2024Quote: ... D-biotin (B4501; Merck) at a final concentration of 500 µM was added to induce the RUSH.
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Biophysics 2020Quote: 19) Potassium chloride (KCl, Merck, CAS # 7447-40-7)
-
bioRxiv - Microbiology 2021Quote: ... Cuttings were transferred in magenta GA-7 vessels (Merck), incubated at 28°C ...
-
bioRxiv - Immunology 2022Quote: ... mouse CC1 Anti-APC (Ab-7) (#OP80-100UG, Merck) and mouse anti-Olig2 (#66513-1-IG ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7% FBS (BioWest) and 10μg/mL Blasticidin hydrochloride (Merck)45.
-
bioRxiv - Physiology 2019Quote: ... The hPCLS were treated with 10ng/ml recombinant human TGFß 1 protein (R&DSystems#240-B-010) and 25µM (in 750µl of DMEM) of GM6001 (Merck#CC1010). Lived dead staining was carried out using calcein-am/ ethidium homodimer kit (ThermoFisher#L3224 ...
-
bioRxiv - Microbiology 2019Quote: ... and stained with fresh 1:10 Giemsa (Merck) solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Biochemistry 2023Quote: ... and centrifuging in 10 K (3 K for dA) ultra-centrifugal filters Amicon® (Merck KGaA, Darmstadt, Germany). This process was repeated five times to dialyze the ligand ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were plated at 30,000 cells/well in 1/20 poly-D-lysine (Merck Milipore) precoated Costar Black (Corning ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were treated with 100 μM DRB (5,6-Dichlorobenzimidazole 1-β-D-ribofuranoside; Merck, D1916) or with 5 μg/ml α-amanitin (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... MDM were incubated with or without previously optimized concentrations of 1 µM cytochalasin D (Merck), 1 µM jasplakinolide (Abcam ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ACV(9-[(2-Hydroxyethoxy)methyl]guanine) was obtained as a gift sample from Merck, India ...
-
bioRxiv - Biophysics 2021Quote: Fmoc (9-fluorenylmethyloxycarbonyl)-amino acids were obtained from Novabiochem (Merck Biosciences, La Jolla, CA). Rink amide MBHA resin (0.65 mmol/g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Camptothecin (208925), rubitecan (9-nitrocamptothecin, R3655) and topotecan hydrochloride (T2705) were obtained from Merck Life Science.