Labshake search
Citations for Merck :
51 - 100 of 4010 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 10 g/L NaCl (Merck, Darmstadt, Germany), and 5 g/L yeast extract (HiMedia Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mM HEPES pH 7.2 (Merck, Darmstadt, Germany; CAS-No: 7365-45-9). TaC12 cells were washed with PBS and incubated with 1 mM PBS/EDTA (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... rat immunoglobulin (Ig) G (Merck, 2-5μg/ml), U0126 (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... with PBS pH 7.4 for 10 min at 4400 x g and 4°C using an Amicon Ultra-4 concentrator with 3 kDa cutoff (Merck Millipore). The degree of labelling (DOL = 1.96 ...
-
bioRxiv - Microbiology 2023Quote: ... 100 ml of the cell suspension at an OD660 of 0.6 was harvested by centrifugation at 5,000×g for 10 min at 4°C and resuspended in 2 ml of BugBuster (Merck), and 50 μg/ml lysozyme and 1 mM phenylmethanesulfonyl fluoride (PMSF ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 g/L sodium chloride (Merck, S3014-1kg). Following overnight growth ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mitomycin C (10 g/mL) (Merck, Darmstadt, Germany) was then used to treat the cells for two hours and using the tip of a 200 µL pipette ...
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with media containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Developmental Biology 2022Quote: ... During day 13 to 15 they were treated with 2 pulses of 3μM CHIR99021 (Merck, 361571) to dorsalise the tissue ...
-
bioRxiv - Cell Biology 2023Quote: ... or 2-deoxy-glucose (2-DG; 500 μg/g) (25972, Merck Life Sciences) were injected IP at Day 0 ...
-
bioRxiv - Physiology 2020Quote: ... 3.) C + 0.3 g/kg vitamin E (Merck KGaA, Darmstadt, Germany) (vit E diet) ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were centrifuged (12,000 g – 10 min) and supernatants were passed through 3 kDa Amicon Ultra-0.5 Centrifugal Filter Units (Merck Millipore, catalogue no. UFC500396) for 45 min at 12,000 g at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Immunology 2020Quote: ... Cell supernatants were centrifuged at 500 ×g for 5 minutes to remove dead cells and concentrated using 10 kDa MW cut-off filters (Amicon, Merck Millipore), as described by the manufacturer ...
-
bioRxiv - Immunology 2023Quote: ... Cell supernatants were centrifuged at 500 ×g for 5 min to remove dead cells and concentrated with 10 kDa MW cut-off filters (Amicon, Merck Millipore), as described by the manufacturer ...
-
bioRxiv - Genetics 2023Quote: ... in 27 ml of ESC medium with 8 µg/ml Polybrene (Merck, TR-1003-G) and the lentiviral gRNA library ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Systems Biology 2020Quote: ... biotin (13 μM, Merck, B4639) was added for protein biotinylation ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2022Quote: ... medium was replaced with the culture medium containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Cell Biology 2023Quote: ... and then embedded in BMM resin (butyl methacrylate, methyl methacrylate, 0.5% benzoyl ethyl ether with 10 mM DTT (Merck)) at -20°C under UV light for polymerization ...
-
bioRxiv - Biophysics 2020Quote: ... 50 µl of 5% w/v (145000 g/mol) PVA (Merck) solution in water was spread on a cleaned (rinsed in ethanol and double distilled water ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2023Quote: ... We used sterile-filtered 3 % bovine serum albumin (BSA heat shock fraction, pH 7, > 98 %, Merck) in 1 × Pierce PBS buffer (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... To prevent unspecific labelling the sections were incubated for 2 × 10 minutes in PB solution containing 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Neuroscience 2023Quote: ... To avoid unspecific labelling the sections were first incubated for 2 × 10 minutes in a solution of PB with 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Immunology 2023Quote: ... were premixed at a 1:9 molar ratio or a 2:98 molar ratio in chloroform (Merck) to arrive at PLBs harboring Ni-DOGS-NTA at 10% or 2% ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Biophysics 2022Quote: ... with 4.5 g/l glucose supplemented with 10% FBS (Merck), 1 mM sodium pyruvate (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Viral pellets were resuspended in culture medium supplemented with 8 μg/ml Polybrene (Merck, TR-1003-G) and 10 μM Y-27632 (Selleckchem ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Cell Biology 2023Quote: ... reagent (chlortrimethylsilane [Merck KGaA, Darmstadt, Germany]/1.1.1.3.3.3-Hexamethyldisilasane [Sigma Aldrich, Co., St. Louis, MO, U.S.A]/pyridine [Merck KGaA, Darmstadt, Germany], 9:3:1) in a GC vial for GC-MS-SIM non-cholesterol analysis ...
-
bioRxiv - Plant Biology 2021Quote: ... Pure standards of (Z)-3-hexenyl acetate (Z3HAC, 98 %, CAS number 3681-71-8, Merck) was used in different concentrations ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Biochemistry 2023Quote: ... the reduced cysteine residues were blocked employing a 10 mM solution of S-methyl methanethiosulfonate (MMTS) (Merck KGaA, Darmstadt, Germany) at room temperature for 10 minutes ...
-
Tracer-based metabolomics for profiling nitric oxide metabolites in a 3D microvessel-on-a-chip modelbioRxiv - Cell Biology 2023Quote: ... 10 µM of (6R)-5,6,7,8,- Tetrahydrobiopterin dihydrochloride (BH4) (Merck, 69056-38-8) and 1% FBS (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... containing solid (7 g L−1 agar) full-strength Hoagland (2.75 mL well−1; pH adjusted to 6.5) (Sigma-Aldrich, Merck), sealed with parafilm and placed under the growth chamber ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pH 7 using repetitive washing and centrifugation with an Amicon 3 kDa MWCO centrifugal filter (Merck Millipore). For the synthesis of ditopic A’-A’ CC ligand ...
-
bioRxiv - Biophysics 2022Quote: ... and were dissolved in a mixture of chloroform / methanol (7:3 vol/vol, both from Merck KGaA) to yield four stock solutions at 1.5 mM lipid concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...