Labshake search
Citations for Merck :
1 - 50 of 5424 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4-hydroxy-tamoxifen (Merck H7904) was solubilized in 100% ethanol ...
-
bioRxiv - Biophysics 2019Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Molecular Biology 2019Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 nM 4-hydroxy-tamoxifen (OHT; Merck) was added to the medium 48 hours before treatment with IACS-010759 or other drugs ...
-
bioRxiv - Cancer Biology 2020Quote: ... and tamoxifen (1uM 4-hydroxy-tamoxifen, Merck, Australia) treatments ...
-
bioRxiv - Biophysics 2020Quote: ... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Immunology 2021Quote: ... either 4′,6-Diamidine-2′-phenylindole dihydrochloride (Merck) or LIVE/DEAD™ Fixable Near-IR stain kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); Dox-NP (300112 ...
-
bioRxiv - Genetics 2022Quote: ... they were treated with 200nM 4-hydroxy tamoxifen (Merck Millipore) to activate CreER recombination which results in cells becoming Δ/+ (fl/+ cells become Adar1 heterozygous ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Merck Life Science) 0.1 µg/mL was added to the medium to exclude dead cells.
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Merck #10236276001) at a final concentration of 1 µg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, #10236276001, Merck) staining ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Staining cryosections with 4’,6-diamidino-2-phenylindole (DAPI, Merck) and active caspase-3 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Merck Millipore) and mounted on slides with Mowiol (Merck Millipore ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... and nuclei staining with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 10 minutes at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Merck) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Sections were incubated with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 20 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were then treated for 14 days with 400nM 4-hydroxy tamoxifen (Merck Millipore) and genotyped to confirm complete recombination ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were treated for 14 days with 400nM 4-hydroxy tamoxifen (Merck Millipore) then genotyped to confirm complete recombination ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were treated for four days with 400nM 4-hydroxy tamoxifen (Merck Millipore) then genotyped to confirm complete recombination ...
-
bioRxiv - Plant Biology 2022Quote: ... MeFox (pyrazino-s-triazine derivative of 4a-hydroxy-5-methyltetrahydrofolate) was purchased from Merck & Cie (Schaffhausen ...
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were stained with 4′,6-diamidin-2-phenylindol (DAPI, Merck, Germany).
-
bioRxiv - Neuroscience 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (D9542) (all from Merck, Auckland, NZ). See table S2 for antibodies used for immunocytochemistry (ICC).
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were stained with DAPI before mounting with Mowiol (12 mL of 0.2 M Tris buffer pH8.5, 6 mL distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore).
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Developmental Biology 2022Quote: ... Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT, 11383213001, Merck-SIGMA) and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP ...
-
bioRxiv - Cell Biology 2019Quote: ... cleared extracts were incubated 2h-6h at +4°C in an orbital shaker with anti-FLAG sepharose beads (M2 clone, Merck, A2220). Bound complexes were pelleted and 5x washed (Lysis buffer with 1M NaCl) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 500 µl 0.2 µg/ml 4’,6’-diamidino-2-phenylindole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: ... Following counterstaining with 4’,6-diamidino-2-phenylindole (DAPI; Vectashield/Biozol) slices were mounted in Mowiol 4-88 (Merck Chemicals).
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Cell Biology 2021Quote: 6 μL of 70 kDa FITC-dextran in EGM-2 (5 mg/mL, Merck, #46945) was added to each vessel ...
-
bioRxiv - Biophysics 2021Quote: ... 6h) and purified using 100kDa Amicon ®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at -20°C.
-
bioRxiv - Biophysics 2020Quote: ... 6h) and purified using 100kDa Amicon®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at −20°C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Molecular Biology 2019Quote: ... from an 18500g centrifugation (6 min at +4°C) were run through 3-kDa cut-off centrifugal filters (Amicon Ultra-0.5 ml, Merck) into pre-weighted collection tubes to remove remaining macromolecules ...