Labshake search
Citations for Merck :
151 - 200 of 4734 citations for 6 methyl N1 4 pyridin 3 yl thiazol 2 yl benzene 1 3 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ACV(9-[(2-Hydroxyethoxy)methyl]guanine) was obtained as a gift sample from Merck, India ...
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Molecular Biology 2023Quote: ... Diamine Oxidase from porcine kidney with lot number 011M7015 / SLCG5608 was also obtained from Merck. The enzyme was stored at -20°C until use ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µl of each dilution were mixed with 10 µl of 0.4 mg ml-1 4-methyl-umbelliferyl-β-D- galactopyranoside (MUG) substrate (Merck, Darmstadt, Germany) that was prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were mounted using a 3:1 solution of Canada balsam (Merck, # 1016910100) and Histoclear (HS-202 HISTO-CLEAR II ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with the nucleus DNA stain 4′,6-diamidino-2-phenylindole (DAPI) (1μg/ml D9542-10MG, Merck Life Science UK Ltd ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Neuroscience 2019Quote: ... further immunolabeling was used either against Vesicular Glutamate Transporter 3 (1:2000, VGluT3; Merck, Cat#AB-5421 ...
-
bioRxiv - Molecular Biology 2022Quote: ... faecalis was diluted 1:100 into 3 L of Brain heart infusion (BHI, Merck) and grown at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) and concentrated using a 3 kDa MWCO Centriprep concentrators (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...