Labshake search
Citations for Merck :
351 - 400 of 5182 citations for 6 methyl 5 6 7 8 tetrahydro 1 3 dioxolo 4 5 g isoquinolin 6 iumchloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Products were separated on a LiChroCART 125-4 RP-18 end-capped 5 µm column (Merck, Darmstadt, Germany) with a solvent system of methanol and phosphoric acid (0.1% ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked for 3 hr in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with sgRNA lentiviruses at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours and then reprogramming was initiated by addition of reprogramming medium ...
-
bioRxiv - Immunology 2020Quote: ... Cell supernatants were centrifuged at 500 ×g for 5 minutes to remove dead cells and concentrated using 10 kDa MW cut-off filters (Amicon, Merck Millipore), as described by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... After centrifugation for 5 minutes at 18 000 g the DNA pellet was washed twice with one mL 70% Ethanol (Merck Millipore) followed by 5 minutes centrifugation at 18 000g ...
-
bioRxiv - Microbiology 2021Quote: ... and the remaining sample was centrifuged at 10000 g for 5 min and filtered through a 0.2 μm pore Millipore filter (Merck, KGaA, Germany) previously wetted with 1 ml of 0.9% NaCl solution ...
-
bioRxiv - Microbiology 2021Quote: ... they were centrifuged at 10000 g for 5 min and filtered through a 0.2 μm pore Millipore filter (Merck, KGaA, Germany) previously wetted with 1 ml of 0.9% NaCl solution ...
-
bioRxiv - Immunology 2022Quote: ... The remaining volume was spun down at 500x g for 5 minutes and resuspended in 12 ml FACS buffer (PBS [Gibco]+ 0.5% BSA [Merck] + 2mM EDTA). The suspension was transferred over a 70 μm SmartStrainer (Miltenyi Biotec) ...
-
bioRxiv - Immunology 2023Quote: ... Cell supernatants were centrifuged at 500 ×g for 5 min to remove dead cells and concentrated with 10 kDa MW cut-off filters (Amicon, Merck Millipore), as described by the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Microbiology 2021Quote: ... was cultured in high-glucose (4.5 g × ml−1) Dulbecco’s modified Eagle’s medium (DMEM) containing 4 mM stable glutamine (Merck) and supplemented with 6% inactivated fetal calf serum (iFCS ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Methanol extracts were diluted 1:5 in Milli-Q water (Merck, Darmstadt, Germany) and subjected to reversed phase HPLC-MS using an Accela 1250 HPLC system equipped with a Hypersil Gold aQ column and coupled to a QExactiveTM mass spectrometer (all from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM β-mercaptoethanol and 1% (v/v) complete protease inhibitor cocktail (Merck). The protein concentration was quantified in crude extracts with the Bradford assay (Bradford ...
-
bioRxiv - Physiology 2024Quote: ... Mice also received Prednisolon (1 mg/kg diluted in 5 % glucose i.p., Merck) up to 10 days post-surgery to reduce the potential immune response to the LV-vectors.
-
bioRxiv - Cell Biology 2021Quote: ... and 5 U ml−1 penicillin and 50 μg ml−1 streptomycin (Merck Life Science (Sigma)) at 37 °C and 5% CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μm and 0.22 μm filter pore size (Fig. 5) (Whatman filter, Merck KGaA, Darmstadt, Germany) using sterilised filtration units (Nalgene ...
-
bioRxiv - Biochemistry 2021Quote: ... antipapain and pepstatin A) supplemented with 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore). After incubation at 4°C for 30 minutes to assure the complete lysis ...
-
bioRxiv - Plant Biology 2019Quote: ... fresh stem sections were counterstained for 5 min by 5 µg/ml propidium iodide (PI, Merck) dissolved in tap water or 0.01 % Direct Red 23 (Sigma-Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... 3.) C + 0.3 g/kg vitamin E (Merck KGaA, Darmstadt, Germany) (vit E diet) ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% FBS superior (Merck) and 2*105 units/ml Recombinant Human FGF-basic (PeproTech Inc.) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 μM PD98059 (Merck Millipore), which target p38 and MEK1 ...
-
bioRxiv - Cell Biology 2022Quote: ... in 5% acetic acid (1.00063.1000; Merck). Membranes were blocked for 1 h at RT with 5% non-fat milk in PBS-T (1X PBS ...
-
bioRxiv - Pathology 2022Quote: ... for 5 minutes with pronase (MERCK, cat ...
-
bioRxiv - Microbiology 2019Quote: ... and 5% water in Acetone (Merck) overnight at -90°C in an Arctiko DP-80 cryo porter (Arctiko ...
-
bioRxiv - Microbiology 2021Quote: ... 250 μl of 5% glutaraldehyde (Merck) in 0.2M cacodylate buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... Cyanine 5 (#SIC006-5X1NMOL, Merck AG).
-
bioRxiv - Cell Biology 2022Quote: ... and 5% ChemiBLOCKER (Merck Millipore, #2170) in 0.1 M NaP ...
-
bioRxiv - Microbiology 2023Quote: ... 5% bovine serum albumin (BSA; Merck) was added to cells for 60 minutes to reduce non-specific binding ...
-
bioRxiv - Neuroscience 2023Quote: ... bovine insulin (5 µg/mL, Merck) was added after 7 days in culture ...
-
bioRxiv - Microbiology 2023Quote: ... 5% formic acid (FA, Merck-Millipore) twice for 20 min ...
-
bioRxiv - Physiology 2023Quote: ... 5% donkey serum (Merck, Darmstadt, Germany) and 1% DMSO in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μg/ml insulin (Merck, I9278), 100 μg/mL transferrin ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5% normal sheep serum (Merck). Incubation with primary antibodies was done for 12 to 72 hours at 8 °C in PBS-T with 3% BSA and 0.02% sodium azide ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... absolute ethanol (Merck: 64-17-5), Oil-red-O (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 μg/ml human insulin (Merck), and 50 μM hydrocortisone (Cayman ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Fixed cells were washed with cold PBS and centrifuged at 2000 x g for 5 minutes and stained using a Muse™ Cell Cycle Kit (Merck Millipore) for 30 minutes in dark conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... Pellets were thawn on ice and resuspended in lysis buffer (5 mL/g pellet: 50 mM Na2HPO4/KH2PO4, 150 mM NaCl, 0.2 % Tergitol™ solution (Merck, Darmstadt, Germany), and 2 mM DTT ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were left to soak for no less than 24 hours in either plain water (for the cryptic/plain treatment) or a 2.5% Bitrex™ aqueous solution (5 g denatonium benzoate (Merck, Darmstadt, Germany) dissolved into 200 ml water ...
-
bioRxiv - Biophysics 2022Quote: ... NaCl (40 g) and KCl (1 g) procured from Merck.
-
bioRxiv - Genetics 2023Quote: ... in 27 ml of ESC medium with 8 µg/ml Polybrene (Merck, TR-1003-G) and the lentiviral gRNA library ...