Labshake search
Citations for Merck :
501 - 550 of 1992 citations for 6 chloro 4 hydroxyquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... actin was let to polymerize in PBS for 30 min at room temperature before adding 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholiniumchloride (DMTMM, MERCK) cross-linker ...
-
bioRxiv - Genomics 2020Quote: ... Free nucleic acids were then digested with 60 units/ml Benzonase Nuclease (Merck) for at least 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... we tried to contrast the lysis stimulation by contemporarily adding tranexamic acid (Merck) at a final concentration of 100 μM ...
-
bioRxiv - Neuroscience 2019Quote: ... The peptides were acidified to a total concentration of 1% Formic Acid (Merck). Samples were cleaned up using OASIS sample cleanup cartridges (Waters ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 g 2-(N-morpholino)ethanesulfonic acid (ULTRON grade, Merck KGaA, Darmstadt, Germany), and 5 g Gelrite (Duchefa) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The spectrum was collected after addition of 2,5-dihydroxybezoic acid matrix substance (Merck) using an UltrafleXtremeTM MALDI-TOF/TOF mass spectrometer (Bruker Daltonics ...
-
bioRxiv - Neuroscience 2021Quote: ... 10mM Hepes and 1% MEM amino acids (all obtained from Merck, Darmstadt, Germany). Cells were grown for two weeks ...
-
bioRxiv - Immunology 2020Quote: ... N’N’-tetramethyluronium-hexafluoro-phosphate (HBTU) and trifluoroacetic acid (TFA) were purchased from Merck Millipore (Merck KGaA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were split at 80% confluence using trypsin-ethylenediaminetetraacetic acid (trypsin EDTA; Merck), spun at 200 x g for 5 minutes to pellet and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and stop solution (0.16 M Sulfuric Acid (Merck cat. No. 7664-93-9)) were prepared in-house ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Glacial acetic acid and Acetonitrile used are of HPLC grade procured from Merck Millipore (Millipore Sigma ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... 400 µL of 1% 2-thiobarbituric acid (TBA; Merck, St. Charles, MO, USA), and 200 µL of 20% phosphoric acid and heated at 100 °C for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 mM ascorbic acid) and filtered through a layer of Miracloth (Merck Millipore) for two times ...
-
bioRxiv - Cell Biology 2023Quote: ... Released glycans were fluorescently labeled with 8-aminopyrene-1,3,6-trisulfonic acid (APTS, Merck). Briefly ...
-
bioRxiv - Developmental Biology 2023Quote: ... and counterstained with modified Harris Hematoxylin (Epredia) differentiated with 1% acetic acid (Merck) for optimal stain intensity ...
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... formic acid and IPA in HPLC grade were purchased from Merck (Darmstadt, Germany). Purified water was produced by Elga Purelab Ultra (Celle ...
-
bioRxiv - Cell Biology 2023Quote: ... the pH of milk was adjusted to pH 4.6 by hydrochloric acid (Merck) followed by centrifugation at 4000×rpm (Beckman ...
-
bioRxiv - Microbiology 2023Quote: ... and the protein concentration was determined by bicinchoninic acid (BCA) assay (Merck Millipore) and by UV-visible spectroscopy using an ε of 24 mM⁻¹·cm⁻¹ at 280 nm ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB; 4% PFA in PB, pH 7.4; Merck).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were fixed with 4% paraformaldehyde (Merck) for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 250 U/mL benzonase (Merck, 70746-4)) on ice for 1 hour prior to centrifugation at 4°C (20kg ...
-
bioRxiv - Microbiology 2019Quote: ... Fmoc-Lys(Biotin)-OH (4 eq; Merck) in 6 ml DMSO:NMP (1:1 ...
-
bioRxiv - Microbiology 2020Quote: ... Calpain 4 (1:500, MAB3083, Merck Millipore), Calpastatin (1:1000 ...
-
bioRxiv - Biophysics 2021Quote: ... 4 mM CaCl2 (Merck Life Science, Norway) and 25 μM fluorescein sodium salt (Merck Life Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.8×10-4 M adenine (Merck, A3159), 0.5 µg/ml hydrocortisone (Merck ...
-
bioRxiv - Pathology 2022Quote: ... fixed (4% paraformaldehyde; Merck, #1.04005.1000 in PBS)(24h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 nM 4-hydroxy-tamoxifen (OHT; Merck) was added to the medium 48 hours before treatment with IACS-010759 or other drugs ...
-
bioRxiv - Immunology 2020Quote: ... and Polybrene (4 μg/ml; Merck Millipore) in a total volume of 7 ml (2 ml of a 15-min-preincubated transfection mix in serum-free DMEM added to 5 ml of fresh full DMEM) ...
-
bioRxiv - Physiology 2021Quote: ... and fixed with 4% paraformaldehyde (Merck, 104004), prior to fluorescent quantitation.
-
bioRxiv - Cancer Biology 2020Quote: ... fixed in 4% paraformaldehyde (Merck, Darmstadt, Germany) and subjected to flow cytometric analysis on a BD FACS Canto II (BD Biosciences ...