Labshake search
Citations for Merck :
51 - 100 of 2445 citations for 6 METHYL 3 1H TETRAZOL 5 YL 4H CHROMEN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... To each tube 1 μL of Tris((1-benzyl-4-triazolyl)methyl)amine (TBTA) solution (2.5 mM in DMSO; Merck), 10 μL of Tetrakis(acetonitrile)copper(I ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... Surfaces were functionalised by flooding the device with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500™ (3M™) ...
-
bioRxiv - Biochemistry 2024Quote: ... Diener Electronic) followed by channel surface functionalization using 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Merck) in HFE-7500™ (3M™ Novec™).
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... and nuclei staining with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 10 minutes at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Merck) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... Sections were incubated with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 20 min ...
-
bioRxiv - Microbiology 2023Quote: ... and then treated with one mL of bleaching solution [Water + 4% NaOCl (Merck) +1N NaOH (HiMedia ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Physiology 2020Quote: ... and embedded in methyl methacrylate (MMA; Merck). The received block was additionally referenced for further control with the milling of three opposing grooves.
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 1h and 2% glacial acetic acid (Merck) for 1h ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were stained with DAPI before mounting with Mowiol (12 mL of 0.2 M Tris buffer pH8.5, 6 mL distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore).
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were shortly rinsed in distilled water and mounted using Mowiöl (12 ml of 0.2 M Tris buffer, 6 ml distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore). Samples were imaged directly or within the next 48h ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µl of each dilution were mixed with 10 µl of 0.4 mg ml-1 4-methyl-umbelliferyl-β-D- galactopyranoside (MUG) substrate (Merck, Darmstadt, Germany) that was prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2021Quote: ... After blocking for one hour in PBST with 5% normal goat serum (Merck G9023) and 0.1% BSA ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Bioengineering 2020Quote: ... the master was first placed in a vacuum desiccator beside a glass petri dish containing a droplet of trichloro(1H,1H,2H,2H-perfluorooctyl)-silane (Merck KGaA, Darmstadt, Germany), which subsequently coated the surface of the master with a hydrophobic layer allowing easy future peeling of the polydimethylsiloxane (PDMS ...
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were stained with 4′,6-diamidin-2-phenylindol (DAPI, Merck, Germany).
-
bioRxiv - Neuroscience 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (D9542) (all from Merck, Auckland, NZ). See table S2 for antibodies used for immunocytochemistry (ICC).
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2022Quote: ... Following counterstaining with 4’,6-diamidino-2-phenylindole (DAPI; Vectashield/Biozol) slices were mounted in Mowiol 4-88 (Merck Chemicals).
-
bioRxiv - Bioengineering 2019Quote: ... The supernatant was passed through the cartridges (pre-conditioned with 5 mL each of tert-methyl butyl ether, methanol (Merck; laboratory grade purity) and deionised water ...
-
bioRxiv - Physiology 2020Quote: ... at 4°C for 60 min using an Amicon Ultra-4 3 kDa centrifugal filter device (Merck Millipore). The 50 μL retentate was the final volume of concentrated EVs ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Genomics 2024Quote: ... Cells were then resuspended in 100µL RPMI + 10% FCS and stimulated for 4h with PMA (100ng/mL, Merck, P8139) and ionomycin (1µg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated for 48 h with 3 μM 4-hydroxytamoxifen (Merck) and then kept in 300 nM until experimentation ...
-
bioRxiv - Biophysics 2020Quote: ... one cycle for 5 min) in Amicon Ultra 100 kDa MWCO filters (Merck Millipore, Darmstadt, Germany) using reaction buffer (25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2020Quote: ... The internal standard was 1 μL of methyl heneicosanoate (10 mg/mL) and Bacterial acid methyl ester (BAME) mix (Merck-Millipore, Burlington, MA, USA) was used to identify the each peak of fatty acids and analytical standards for each fatty acid were used for quantification.
-
bioRxiv - Plant Biology 2020Quote: DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
bioRxiv - Biophysics 2022Quote: ... sucrose and methyl-β-cyclodextrin (mβCD) were obtained from Merck KGaA ...
-
bioRxiv - Developmental Biology 2023Quote: ... to which 10 µg/mL of methyl stearate (Merck, Singapore) was added as an internal standard ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: OCT-embedded penis sections from humans and rats of 6-8 μm were cut in a cryostat and incubated with or without 4-Hydroxi-TEMPO (4-TEMPOL; Merck, Darmstadt, Germany) 10mM for 30 minutes ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 500 µl 0.2 µg/ml 4’,6’-diamidino-2-phenylindole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...