Labshake search
Citations for Merck :
201 - 250 of 4464 citations for 6 Hydroxy 1 2 benzisothiazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Developmental Biology 2019Quote: The multipotent mouse mesenchymal stem cells, C3H10T1/2 cells (Reznikoff et al., 1973) were cultured on 6-wells TPP plastic culture plates (Merck) or 6-wells Uniflex Flexcell plates (FlexCell Int ...
-
bioRxiv - Neuroscience 2022Quote: ... Following counterstaining with 4’,6-diamidino-2-phenylindole (DAPI; Vectashield/Biozol) slices were mounted in Mowiol 4-88 (Merck Chemicals).
-
bioRxiv - Cell Biology 2023Quote: ... we seeded cells at 2 * 106 cells/ mL in S2 media in 2 mL media/ well in a 6-well plate with either DMSO (D2650, Merck), 2.5 μM CytD (C2618 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6), anti-GFAP (goat polyclonal ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.3 U hexokinase (Scientific Laboratory Supplies) and 1 U glucose-6-phosphase dehydrogenase (Merck) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(1H-Indol-3-yl)-4-oxo-4-phenyl-butyric acid (PEO-IAA; OlChemIm, Olomouc, Czech Republic) and indole-3-carbinol (I3C; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... 6 M urea (Merck), 1% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Biochemistry 2023Quote: ... 40 μg of protein was added to each well and run in Boric acid-Tris buffer (192 mM Boric acid, Merck; 1 mM EDTA, Merck; 0.1% SDS, to pH 7.6 with Tris) at 25 mA for 1.5 h ...
-
bioRxiv - Plant Biology 2020Quote: ... tumefaciens were resuspended in 50 mM MES (2-Morpholinoethanesulfonic acid hydrate) (Duchefa, Haarlem, The Netherlands) - KOH buffer (pH 5.6) containing 2mM NaH2PO4 (Merck, Darmstadt, Germany), 100 µM acetosyringone (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Cell Biology 2024Quote: ... and counterstained with Fast Green (0.04% w/v in 1% acetic acid, Merck, Darmstadt, Germany).
-
bioRxiv - Genetics 2022Quote: ... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell nuclei were stained with DAPI (4 ’,6-diamidino-2-fenilindol) and slides were mounted using FluorSave™ Reagent (Merck Millipore). The sections were observed and visualized on a Leica DM2500 fluorescent microscope (Leica Microsystems) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and formic acid from Merck were used for HPLC separations ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Physiology 2019Quote: ... ethylenediaminetetraacetic acid (EDTA) from Merck.
-
bioRxiv - Biochemistry 2019Quote: ... and glacial acetic acid (Merck) (v/v 85:15 ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Linolenic acid (L2376-500MG, Merck), L-Carnitine hydrochloride (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... folic acid (FA, Merck, #F8758) and 5-methyltetrahydrofolate (5-MTHF ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...