Labshake search
Citations for Merck :
651 - 700 of 4464 citations for 6 Hydroxy 1 2 benzisothiazole 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... and then by AWA (acetone/water/acetic acid 70:29.5:0.5) (Merck, Germany ...
-
bioRxiv - Cancer Biology 2019Quote: ... and formic acid (all analytical grade) were purchased from Merck (Darmstadt, Germany).
-
bioRxiv - Developmental Biology 2021Quote: ... 2X of basal medium eagle’s amino acids solution 50X (Merck, Darmstadt, Germany) and 1X of minimal essential medium nonessential amino acid solution 100X (Merck) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1X of minimal essential medium nonessential amino acid solution 100X (Merck). For culture of embryos with exogenous FGF4 ...
-
bioRxiv - Biophysics 2022Quote: ... HPLC-grade acetonitrile (ACN) and hydrochloric acid (HCl) were purchased from Merck and sodium-azide was procured from SD fine chemicals Ltd ...
-
bioRxiv - Cell Biology 2022Quote: ... and 44µl 90mM p- coumaric acid (Merck, #C9008-5G, solved in DMSO) dissolved in 1ml 1M Tris pH 8.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was quenched by adding formic acid (FA; Merck, Darmstad, Germany) to a final volume of 1% v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the supernatant was acidified with 100% formic acid (#1.00264.0100, Merck, DK). C18 stage tips (UltraMicroSpin Column ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfer was verified by PonceauS stain (0.1% Ponceau, 0.5% acetic acid, MERCK). The membranes were cut depending on the molecular weights of the desired proteins and rinsed in 0.1% TBS tween ...
-
bioRxiv - Cell Biology 2023Quote: ... and 230 µl of the 9 mol/L sulphuric acid (Merck Millipore) was added and mixed ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... 501µg/ml Ascorbic acid and 180⍰µg/ml Human transferrin (Merck, T8158)) and then plated onto non-adherent dishes (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... sodium acetate and formic acid (FA) were obtained from Merck (Darmstadt, DE). Acetonitrile and 0.1% FA were obtained from Biosolve (Valkenswaard ...
-
bioRxiv - Microbiology 2022Quote: ... γ-aminobutyric acid (GABA) standard and deuterium oxide were purchased from Merck GmbH (Darmstadt ...
-
bioRxiv - Biochemistry 2023Quote: ... Methanol (MeOH) and formic acid (FA) were purchased from Merck (Darmstadt, Germany). Acetic acid (AA) ...
-
bioRxiv - Microbiology 2024Quote: ... Human Serum Albumin with or without fatty acids were purchased from Merck. IVIg (Multigam® 5%) ...
-
bioRxiv - Bioengineering 2024Quote: ... containing β-mercaptoethanol and lysed with acid-washed glass beads (G4649; Merck) using the Precellys® 24 instrument with liquid nitrogen cooling (Bertin Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were incubated with 50 µM 17ODYA (17-octadecynoic acid, Merck) added from stock solution in DMSO or with 0.05% DMSO in DMEM containing 2% charcoal-stripped FBS and 30 mM HEPES for 4 h at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellets were then resuspended in 100 µL of 69% Nitric acid (MERCK) and digested O/N at RT ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Biophysics 2021Quote: ... for 1 min in O2 plasma and incubating them with fibronectin (2 μg/mL) (Merck, Darmstadt, Germany) in 100 mM NaHCO3 (pH 8.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... vigorously vortexed for 1 min and leukocytes retrieved by centrifugation were fixed using 2 % paraformaldehyde (Merck #158127) on ice for 10 min and washed with PBS-0.1 % sodium azide solution.
-
bioRxiv - Cancer Biology 2022Quote: ... Phophorylated MEK was detected using anti-phospho MEK 1/2 (residues 218/222 and 222/226, MERCK, catalogue No ...
-
bioRxiv - Immunology 2023Quote: ... were premixed at a 1:9 molar ratio or a 2:98 molar ratio in chloroform (Merck) to arrive at PLBs harboring Ni-DOGS-NTA at 10% or 2% ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.43 mM MgCl2) with the addition of 0.2 mM 1-phenyl-2-thiourea (PTU, Merck, Germany) to block pigmentation ...
-
bioRxiv - Cell Biology 2023Quote: ... Lipids were dissolved in chloroform:methanol (2:1, v:v) and separated by TLC on silica gel 60 (Merck) along with a standard ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...
-
bioRxiv - Bioengineering 2020Quote: ... insulin (n=6; 20 U, Vetsulin, Merck Animal Health, Madison, NJ, USA), 2-deoxy-D-glucose (n=6 ...
-
bioRxiv - Immunology 2021Quote: ... mature macrophages (n=6 individual donors) were detached using Accutase (Merck Millipore), blocked with 10% pooled human serum in PBS for 30 minutes and incubated with various concentrations of rRABV-tG (0-100 μg/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.2 mL of a 0.2 M acetylacetone (Merck, cat# 123—54-6) solution was added to the former solution and kept in a water bath at 70°C for 10 minutes ...
-
bioRxiv - Plant Biology 2024Quote: ... and 0.36 U glucose-6-phosphate dehydrogenase (G6PDH) (G7877; Sigma-Aldrich/Merck) to each tube ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...