Labshake search
Citations for Merck :
401 - 450 of 1312 citations for 6 Chloro chroman 3 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Biophysics 2021Quote: ... anti-6×His and anti-FLAG M2 (Sigma-Aldrich, Merck, USA). The anti-mouse IgG ...
-
Epicardial slices: a 3D organotypic model for the study of epicardial activation and differentiationbioRxiv - Bioengineering 2020Quote: ... and nuclei staining with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 10 minutes at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were then postfixed with 0.8% K3Fe(CN)6 (Merck), 1% OsO4 (Serva ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Merck) for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... the inhibitor 6-amino-4–4-phenoxyphenylethylamino-quinazoline (Merck Millipore, USA) was reconstituted in DMSO at a stock concentration of 1mM and administered at a final concentration of 10nM on Days 0 and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 μM of mitochondrial pyruvate transporter inhibitor UK9055 (Merck, cat. 5048170001) were added to test if mitochondria have the capacity to utilize other substrates than pyruvate ...
-
bioRxiv - Immunology 2022Quote: ... Sections were incubated with DAPI (4′,6-diamidino-2-phenylindole, Merck) for 20 min ...
-
bioRxiv - Immunology 2023Quote: ... Transfections were carried out in 6 well plates using GeneJuice (Merck) with 1 μg of plasmid DNA per well ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting product was cloned into a pBAC-6 vector (Merck) by In-Fusion cloning (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... or 200 µM C6-ceramide (d18:1/6:0) (Avanti/Merck) for 2h (ethanol vehicle) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8-Hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS) was purchased from Merck and used as received ...
-
bioRxiv - Biochemistry 2021Quote: All amino acids and resins were purchased from Novabiochem (Merck, Darmstadt, Germany) and Carbosynth (Compton ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... a buffer exchange to 0.1% formic acid (Merck Millipore, Burlington, MA, USA) was performed using centrifugal molecular cut-off filters (Merck Millipore ...
-
bioRxiv - Bioengineering 2022Quote: ... which was stopped through acidification with 5 μl of trifluoroacetic acid (Merck). Fifteen μg of each resulting peptide mixture were then desalted on Stage Tip (Rappsilber et.al. ...
-
bioRxiv - Plant Biology 2021Quote: ... and then by AWA (acetone/water/acetic acid 70:29.5:0.5) (Merck, Germany ...
-
bioRxiv - Cancer Biology 2019Quote: ... and formic acid (all analytical grade) were purchased from Merck (Darmstadt, Germany).
-
bioRxiv - Synthetic Biology 2020Quote: ... nucleic acids were digested by addition of 1 µL benzonase (Merck KGaA) and 10 µL 1 M MgSO4 followed by incubation at room temperature for 10 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2X of basal medium eagle’s amino acids solution 50X (Merck, Darmstadt, Germany) and 1X of minimal essential medium nonessential amino acid solution 100X (Merck) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1X of minimal essential medium nonessential amino acid solution 100X (Merck). For culture of embryos with exogenous FGF4 ...
-
bioRxiv - Biophysics 2022Quote: ... HPLC-grade acetonitrile (ACN) and hydrochloric acid (HCl) were purchased from Merck and sodium-azide was procured from SD fine chemicals Ltd ...
-
bioRxiv - Cell Biology 2022Quote: ... and 44µl 90mM p- coumaric acid (Merck, #C9008-5G, solved in DMSO) dissolved in 1ml 1M Tris pH 8.5 ...
-
bioRxiv - Immunology 2022Quote: ... and 1 mM ethylendiamine tetraacetic acid (EDTA) (#EDS-100G, Sigma-Aldrich, Merck) in Ca/Mg-free PBS (#14190-169 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was quenched by adding formic acid (FA; Merck, Darmstad, Germany) to a final volume of 1% v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the supernatant was acidified with 100% formic acid (#1.00264.0100, Merck, DK). C18 stage tips (UltraMicroSpin Column ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... 501µg/ml Ascorbic acid and 180⍰µg/ml Human transferrin (Merck, T8158)) and then plated onto non-adherent dishes (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... and 230 µl of the 9 mol/L sulphuric acid (Merck Millipore) was added and mixed ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfer was verified by PonceauS stain (0.1% Ponceau, 0.5% acetic acid, MERCK). The membranes were cut depending on the molecular weights of the desired proteins and rinsed in 0.1% TBS tween ...
-
bioRxiv - Biochemistry 2023Quote: ... sodium acetate and formic acid (FA) were obtained from Merck (Darmstadt, DE). Acetonitrile and 0.1% FA were obtained from Biosolve (Valkenswaard ...
-
bioRxiv - Microbiology 2022Quote: ... γ-aminobutyric acid (GABA) standard and deuterium oxide were purchased from Merck GmbH (Darmstadt ...
-
bioRxiv - Biochemistry 2023Quote: ... Methanol (MeOH) and formic acid (FA) were purchased from Merck (Darmstadt, Germany). Acetic acid (AA) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Gamma-aminobutyric acid (GABA, rabbit, 1:300, Sigma, Merck, Germany, A2052); anti-Green Fluorescent Protein (GFP ...
-
bioRxiv - Bioengineering 2024Quote: ... containing β-mercaptoethanol and lysed with acid-washed glass beads (G4649; Merck) using the Precellys® 24 instrument with liquid nitrogen cooling (Bertin Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were incubated with 50 µM 17ODYA (17-octadecynoic acid, Merck) added from stock solution in DMSO or with 0.05% DMSO in DMEM containing 2% charcoal-stripped FBS and 30 mM HEPES for 4 h at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellets were then resuspended in 100 µL of 69% Nitric acid (MERCK) and digested O/N at RT ...
-
bioRxiv - Microbiology 2024Quote: ... Human Serum Albumin with or without fatty acids were purchased from Merck. IVIg (Multigam® 5%) ...
-
bioRxiv - Cancer Biology 2024Quote: ... stained with 0.057% Sulforhodamine B solution in 1% acetic acid (Merck, #230162) and washed twice with a 1% acetic acid solution in water ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...