Labshake search
Citations for Merck :
251 - 300 of 1596 citations for 6 Chloro 3 methyl 4 pyridinemethanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Biochemistry 2020Quote: ... actin was let to polymerize in PBS for 30 min at room temperature before adding 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholiniumchloride (DMTMM, MERCK) cross-linker ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB; 4% PFA in PB, pH 7.4; Merck).
-
bioRxiv - Cell Biology 2020Quote: ... Cells were fixed with 4% paraformaldehyde (Merck) for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 250 U/mL benzonase (Merck, 70746-4)) on ice for 1 hour prior to centrifugation at 4°C (20kg ...
-
bioRxiv - Microbiology 2019Quote: ... Fmoc-Lys(Biotin)-OH (4 eq; Merck) in 6 ml DMSO:NMP (1:1 ...
-
bioRxiv - Microbiology 2020Quote: ... Calpain 4 (1:500, MAB3083, Merck Millipore), Calpastatin (1:1000 ...
-
bioRxiv - Biophysics 2021Quote: ... 4 mM CaCl2 (Merck Life Science, Norway) and 25 μM fluorescein sodium salt (Merck Life Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.8×10-4 M adenine (Merck, A3159), 0.5 µg/ml hydrocortisone (Merck ...
-
bioRxiv - Pathology 2022Quote: ... fixed (4% paraformaldehyde; Merck, #1.04005.1000 in PBS)(24h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 nM 4-hydroxy-tamoxifen (OHT; Merck) was added to the medium 48 hours before treatment with IACS-010759 or other drugs ...
-
bioRxiv - Immunology 2020Quote: ... and Polybrene (4 μg/ml; Merck Millipore) in a total volume of 7 ml (2 ml of a 15-min-preincubated transfection mix in serum-free DMEM added to 5 ml of fresh full DMEM) ...
-
bioRxiv - Physiology 2021Quote: ... and fixed with 4% paraformaldehyde (Merck, 104004), prior to fluorescent quantitation.
-
bioRxiv - Cancer Biology 2020Quote: ... fixed in 4% paraformaldehyde (Merck, Darmstadt, Germany) and subjected to flow cytometric analysis on a BD FACS Canto II (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... MOWIOL 4-88 (Calbiochem, Merck-Millipore, UK) mounting media was used in combination with 1 μg·mL-1 DAPI in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... galactose-4-sulfate was purchased from Merck KGA (Germany).
-
bioRxiv - Neuroscience 2022Quote: ... followed by 4% paraformaldehyde (PFA) (1004005, Merck) (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg/ml α-Glucosidase (Merck) and incubated at 37℃for 30 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed with 4% paraformaldehyde (Merck) for 10 min and permeabilized for 5 min at room temperature with 0.1% Triton X-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... fixed with 4% para-formaldehyde (PFA, Merck) for 20 min at room temperature (RT ...
-
bioRxiv - Plant Biology 2023Quote: ... and α-amylase (4 U/ml, Merck) in 200 mM sodium acetate– acetic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... and fixed with 4% paraformaldehyde (Merck Millipore) solution for 15 minutes at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4% paraformaldehyde (PFA) (1004005, Merck) (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... collagen-grown cells were collected and incubated with ITGA-6 neutralizing antibody (Merck Millipore #MAB1378 ...
-
bioRxiv - Cell Biology 2022Quote: Wound healing assays were performed in Corning® 6-well plates (Merck, UK). HDF and MSC were individually labelled with cell tracking dyes eBioscience™ CFSE (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Respective ELISA kits (insulin, leptin, IL-6 – MilliPlex Map Mouse Adipokine kit, Merck, Germany ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-acetylated α-tubulin (clone 6-11B-1, Merck; ExM, 1:250), mouse anti-acetylated α-tubulin (T7451 ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...