Labshake search
Citations for Merck :
101 - 150 of 4898 citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Only treatment naive patients that underwent anti-PD-1 monotherapy with either pembrolizumab (200 mg IV every 3 weeks or 400 mg IV every 6 weeks, Merck) or nivolumab (240 mg IV every 2 weeks or 480 mg IV every 4 weeks ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... dried tissue samples (in liquid nitrogen) were dissolved in 3:2:1 mixture of HNO3 (Merck, Germany), H2SO4 (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: ... Anti-alpha tubulin (Merck-SIGMA, clone B-5-1-2) was used as a loading control at 1:10000.
-
bioRxiv - Molecular Biology 2023Quote: ... anti-α-Tubulin (B-5-1-2, Merck Millipore/Sigma) antibodies were purchased ...
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were shortly rinsed in distilled water and mounted using Mowiöl (12 ml of 0.2 M Tris buffer, 6 ml distilled water, 6 g glycerol, 2.4 g Mowiol 4-88, Merck Millipore). Samples were imaged directly or within the next 48h ...
-
bioRxiv - Developmental Biology 2023Quote: ... slides were incubated for 4 h at 4°C with DAPI (1 µg/mL, Merck) and the following secondary antibodies diluted in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Calpain 4 (1:500, MAB3083, Merck Millipore), Calpastatin (1:1000 ...
-
bioRxiv - Biophysics 2020Quote: ... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked using 1x TBST+ 3% Casein followed by overnight incubation at 4°C with biotinylated Lectin from Triticum Vulgaris (Sigma/Merck Cat. No. L5142). The membrane was washed with 1XTBST and further Incubated with Streptavidin PerCP-eFluor710 Conjugated ...
-
bioRxiv - Cell Biology 2022Quote: ... shMYO10 #3 and shMYO10 #4 cell lines were generated using lentiviruses particles containing a non-target control shRNA (Merck, Cat Number: SHC016V-1EA) or shRNA targeting human MYO10 respectively (shMYO10 #3 ...
-
bioRxiv - Biochemistry 2022Quote: ... Loss of Memo was induced by 3 daily intraperitoneal injections with 2mg tamoxifen at age 4 weeks (T5648 Sigma-Aldrich, distributed through Merck, Buchs Switzerland). Memofl/fl littermates without Cre but treated with tamoxifen served as controls ...
-
bioRxiv - Cell Biology 2023Quote: ... For NMR-experiments the proteins were concentrated by repeated ultrafiltration (Amicon Ultra-4 Ultracel-3 kDa centrifugal filter device, Merck Millipore, Burlington, USA).
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated overnight at 4°C in blocking solution containing one of the following primary antibodies: anti-GFAP (1:2000; Merck Millipore) and anti-Iba1 (1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3% casein (Merck) in 20 mM TBS (pH 11.0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nutlin-3 (Merck) was dissolved in DMSO and diluted in saline.
-
bioRxiv - Biophysics 2021Quote: ... Fusion was induced by surfactant replacement with 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) (PFO) ...
-
bioRxiv - Cell Biology 2020Quote: ... pre-cleared extracts (2 mg) were incubated for 4 hr at 4 °C with 2 μg of pan–ADP–ribose binding reagent (MABE1016, Merck) or normal rabbit IgG (2729S ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4-aminopyridine (4-AP) (100 μM, Merck) was bath perfused to isolate direct monosynaptic inputs during photostimulation.
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Genomics 2019Quote: ... and mixed with 1 volume of 1-bromo-3-chloropropane (Merck). Samples were spun (2min ...
-
bioRxiv - Bioengineering 2019Quote: ... For experiments with inhibitors UC2288 (2, 4, and 10 µM) (Merck), LY294002 (5 µM ...
-
bioRxiv - Microbiology 2022Quote: ... the supernatants were concentrated 50-fold using Amicon Ultra-4 centrifugal filters with a molecular weight cut-off of 3 kDa (Merck-Millipore, Burlington, MA, USA). Samples were mixed with 3× Laemmli loading buffer and heated for 3 min at 85 °C before SDS-PAGE analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... the emulsion was destabilized by adding the surfactant 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) on top of the buffer ...
-
bioRxiv - Microbiology 2021Quote: ... One mL of virus stock and 9 mL of MEM-E supplemented with 1% pyruvate (Merck KGaA, Darmstadt, Germany) were added to a conical tube with 16 × 106 SK-6 cells and shaken for 30 minutes at 104 rpm and 37°C ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... 14-3-3 binding was detected using anti-GST monoclonal antibody (Merck).
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated in the presence or absence of aphidicolin 2μM for 3 hours together with cytochalasin B (3μg/ml, Merck Millipore) to block cytokinesis prior to fixation for immunofluorescence.
-
bioRxiv - Developmental Biology 2022Quote: ... the channels where coated/treated with 1% (v/v) Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 (Fluorochem ...
-
bioRxiv - Cell Biology 2019Quote: ... Rac1/3 (23A8, Merck), Rac2 [6] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3% hydrogen peroxide (Merck) was applied to the sections prior to incubation with HRP-conjugated secondary antibodies for 1h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-Alexa647-Azide (Jena Bioscience ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Microbiology 2020Quote: Aciclovir (ACV; 9-[(2-hydroxyethoxymethyl) guanine]) (A-4669; Merck) was dissolved in DMSO at a concentration of 10 mg/mL stored as single-use aliquots at −20 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Microbiology 2023Quote: ... 2–3 mL of stock solution was applied onto preparative TLC plates (glass, Merck, 20×20 cm ...