Labshake search
Citations for Merck :
551 - 600 of 1414 citations for 6 CHLOROPURINE RIBOSIDE 5' O MONOPHOSPHATE SODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... leaf samples were harvested with a 6-mm-diameter cork borer (Z165220; Merck-Sigma-Aldrich), resulting in leaf discs with an area of 0.283 cm² ...
-
bioRxiv - Physiology 2022Quote: ... Food contained low melting agar (OmniPur® Agarose, Low Melting, CAS 9012-36-6, Merck) during lifespan assessments only to ensure the quality of compounds was preserved ...
-
bioRxiv - Microbiology 2022Quote: ... The sample was then injected into a Superose® 6 Increase 10/300 GL (Merck) column ...
-
bioRxiv - Neuroscience 2022Quote: ... Agarose 0.6% brain phantoms50 were prepared by dissolving agarose (A9539, CAS 9012-36-6, Merck) in tris-borate-EDTA buffer 1X (T4415 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 500 µl 0.2 µg/ml 4’,6’-diamidino-2-phenylindole (DAPI, Merck, catalog no. D9542) in PBS was added for 15 min at RT ...
-
bioRxiv - Biophysics 2024Quote: ... The coated coverslips were rinsed twice with ethanol before incubation in 6% acetic acid (Merck) for 30 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Microbiology 2019Quote: ... The pellet was dissolved in three ul distilled water and spotted onto 5×5 cm silica gel plates (Merck) using automatic TLC sampler ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Neuroscience 2021Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... was used to remove non-incorporated HCQ and ethanol to obtain the liposomal HCQ in 0.9% sodium chloride (Merck KGaA, Germany).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto 45-μm polyvinylidene difluoride (PVDF) membrane (IPVH00010, Merck Millipore). Membranes were blocked using 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween 20 (655204 ...
-
bioRxiv - Immunology 2022Quote: ... resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with Laemmli running buffer and transferred to PVDF membranes (Merck-Millipore) in a Trans-Blot® SD Semi-Dry Transfer Cell (Bio-Rad) ...
-
bioRxiv - Microbiology 2022Quote: ... Sodium dodecyl sulfate (final concentration, 1 mg/mL) and proteinase K (final concentration, 1 mg/mL; MERCK Group Japan, Tokyo, Japan) were added to the sample ...
-
bioRxiv - Neuroscience 2022Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... freeze-dried mucin-MA and unreacted mucin samples were separately dissolved at 1 mg mL−1 in 0.1 M sodium bicarbonate buffer pH 8.5 (Merck, Kenilworth, NJ, USA). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 10% (v/v) fetal bovine serum, 1 mM sodium pyruvate (gibco, 11360039) and 1% antibiotic/antimycotic solution (Merck, A5955). Medium was refreshed every 3 days during cultivation and every 24h in an experimental setting ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µg of protein was separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto Immobilon®-P PVDF membrane (Merck), followed by blocking in milk and further overnight probing at 4 °C with a primary antibody specific for Cre (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: The Propidium Iodide (PI) working solution was prepared consisting of 4.35 mL 1 g/L sodium citrate dehydrate (Merck, cat# 6448), 0.5 mL 1 mg/mL DNAse-free RNAase A (Sigma ...
-
bioRxiv - Molecular Biology 2023Quote: ... The samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride membrane (PVDF Transfer Membrane, Merck-Millipore). The primary antibodies used for the detection of proteins are Anti-CRY1 (Bethyl) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Conjugated AB were eluted in 30 μL antibody stabilizer solution (Standard Biotools, CA, USA) supplemented with 0.05 %sodium azide (Merck, Darmstadt, Germany) to a total volume of 50 μL stored in low attachment 1 mL Eppendorf tubes.
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... Mounted cells were fixed in 5% glutaraldehyde (Merck) in 0.1 M cacodylate (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...