Labshake search
Citations for Merck :
251 - 300 of 4838 citations for 6 Bromo 3 N ethylamino 1 2 4 triazolo 4 3 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM EGTA) and fixated for 20 min with 4% paraformaldehyde (Merck). Then ...
-
bioRxiv - Immunology 2022Quote: Murine lungs were perfused and fixed overnight at 4 °C in 4% paraformaldehyde (Merck Millipore) under agitation ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Neuroscience 2019Quote: ... further immunolabeling was used either against Vesicular Glutamate Transporter 3 (1:2000, VGluT3; Merck, Cat#AB-5421 ...
-
bioRxiv - Molecular Biology 2022Quote: ... faecalis was diluted 1:100 into 3 L of Brain heart infusion (BHI, Merck) and grown at 37°C ...
-
bioRxiv - Biophysics 2024Quote: ... 1 mM DTT) and concentrated using a 3 kDa MWCO Centriprep concentrators (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HPLC purification of the (S,S)-MLN-4760 was based on the comparison with the commercially available compound (MLN-4760; MW: 428.31; Merck, CAS N° 305335-31-3). The isolation of the desired (S,S)-diastereoisomers of the respective fluorinated MLN-4760 derivatives was based on the assumption that the HPLC elution sequence of the diastereoisomers would be identical to that of the MLN-4760 lead compound.
-
bioRxiv - Cell Biology 2019Quote: Pooled extracts of additional control pancreas (n=6) and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Neuroscience 2023Quote: Trypsinise Ara-C purified SCs using 1 ml of 6% 2 mg ml-1 Trypsin (Merck - 85450C) in Versene (0.02% EDTA (Thermo Fisher - D/0700/53 ...
-
bioRxiv - Genomics 2020Quote: ... Teratomas that developed within 4 weeks post-injection were harvested and fixed in 4% paraformaldehyde (Merck), embedded in paraffin ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed using 4% paraformaldehyde (Merck, 1040051000) in PBS and permeabilized by CSK buffer (25 mM HEPES pH 7.8 ...
-
bioRxiv - Genetics 2021Quote: ... fixed with 4% paraformaldehyde (PFA, Merck) in PBS (pH = 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... and fixed in 4% paraformaldehyde (Merck) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/ml heparin (Sigma/Merck), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4 g/l thiamine-HCl (Merck), and 40 g/l myo-inositol (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... and Tubulin beta 4 (#T7941, Merck). To do so ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 mM glutamine (Merck KGA, Germany), 1 mM sodium pyruvate (Merck KGA ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 μg/mL PI (Merck, Germany) and 12 μg/mL Hoechst 33342 (Miltenyi Biotec ...
-
bioRxiv - Bioengineering 2023Quote: ... MOWIOL 4-88 Reagent (475904, Merck); LysoTracker Deep Red (L12492 ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4 % PFA (1004005, Merck) (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-Hydroxytamoxifen (4OHT) (Merck Sigma-Aldrich) was added at a final concentration 100 nM for 10-12 hours to induce the recombination of the Lynflallele.
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Immunology 2021Quote: ... Inhibition of the TLR-4 pathway was achieved by treating cells with 2 µM TAK-242 (Merck) for 6 hours before adding particles ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked again and incubated overnight at 4°C with DAPI (1:2000) (Merck) and anti-rabbit AlexaFluor-488 (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Birds from the anxiogenic group received 2.5 mg/kg of β-CCM (β-carboline-3-carboxylic acid-N-methylamide [FG 7142], Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) dissolved in DSMO (Dimethyl Sulfoxide suitable for HPLC ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...