Labshake search
Citations for Merck :
351 - 400 of 4920 citations for 6 AMINO 6 DEOXY 1 2 3 4 DI O ISOPROPYLIDENE D GALACTOPYRANOSIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... plates were washed with PBS and developed with H2O2 and o-phenylenediamine (OPD; Merck-Sigma). The Optical Density (OD ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... and the slices were placed on Millicell membranes (3–4 slices per membrane, 0,4 µm Millicell, Merck Millipore). Slices were cultured in DMEM/F-12 with GlutaMax ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Biophysics 2021Quote: Cells were grown in presence of 1-β-D-Arabinofuranosyl-cytosin (Merck KGaA) at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: Cells were grown in presence of 1-β-D-Arabinofuranosyl-cytosin (Merck KGaA) at 37°C and 5% CO2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... the obtained 2-cell stage embryos were transferred to a fresh drop of KSOM (Merck, cat. # MR-107-D). The IVF with b6d2F1 oocytes and b6casF1 has on average a 2-cell development (fertilization ...
-
bioRxiv - Immunology 2021Quote: ... Mouse peritoneal macrophages (MPMs) were isolated from mice 4 d after the intraperitoneal injection of thioglycollate (Merck & Co.; Kenilworth, NJ, USA) as described previously(Zhang et al. ...
-
bioRxiv - Pathology 2022Quote: ... fixed smears or tissue section were stained for 15 minutes with Auramine O (0.5g AuO, Merck, Darmstadt ...
-
bioRxiv - Immunology 2023Quote: ... Bound antibodies were detected with the horseradish peroxidase (HRP) substrate o-phenylenediamine (Merck KGaA, Darmstadt, Germany). The reactions were stopped with 1 M H2SO4 after 20 min and the absorbance was measured in a microplate reader (Benchmark ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 % Triton-X and 1x BugBuster (Merck Millipore, #70584-4) were added to lyse the bacteria for 30 min at 4 °C with gentle rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM TCEP with 4% SYPRO Orange dye (Merck, #S5692) were filtered in SpinX tubes (Corning ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies (FUS 1:100 Santa Cruz Biotech sc-47711; ISL1 1:500 Abcam ab109517; OLIG2 1:100 R&D Systems AF2418; NFM 1:1000 Merck MAB1621) were added in 1% BSA and incubated at 4degC overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Immunology 2023Quote: ... The substrate solution had previously been prepared by adding one o-Phenylenediamine dihydrochloride tablet (OPD, Sigma-Merck) to 20 mL of a citrate buffer ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Biochemistry 2021Quote: All amino acids and resins were purchased from Novabiochem (Merck, Darmstadt, Germany) and Carbosynth (Compton ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2X of basal medium eagle’s amino acids solution 50X (Merck, Darmstadt, Germany) and 1X of minimal essential medium nonessential amino acid solution 100X (Merck) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1X of minimal essential medium nonessential amino acid solution 100X (Merck). For culture of embryos with exogenous FGF4 ...
-
bioRxiv - Immunology 2023Quote: ... amino acids (10 mM glutamine, asparagine or aspartic acid – all from Merck), or D-glucose (50 mM ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Rink amide MBHA resin and Fmoc-protected amino were purchased from Merck. SPPS was performed on a Liberty Blue automated peptide synthesizer (CEM ...
-
bioRxiv - Microbiology 2021Quote: ... actinomycin D (A1410, Merck), and cycloheximide (037-20991 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cytochalasin D (Merck, #C8273), Nocodazole (Merck ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.6% D-glucose (Merck), 1 mM sodium pyruvate (Nacalai Tesque ...
-
bioRxiv - Physiology 2020Quote: D-Glucose (Merck, 8342) was dissolved in ddH2O and supplemented to the NGM after autoclaving and UVB killed E ...
-
bioRxiv - Cell Biology 2023Quote: ... dihydroxytestosterone (Merck, #D-073) or EtOH as solvent control ...
-
bioRxiv - Cell Biology 2023Quote: Cytochalasin D (Merck C2618) was used at concentrations ranging from 100nM to 10 µM ...
-
bioRxiv - Developmental Biology 2022Quote: Ciliobrevin D (Merck, 250401) 5 mM dimethyl sulfoxide (DMSO ...