Labshake search
Citations for Merck :
1 - 50 of 5130 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Immunology 2019Quote: ... the inhibitor 6-amino-4–4-phenoxyphenylethylamino-quinazoline (Merck Millipore, USA) was reconstituted in DMSO at a stock concentration of 1mM and administered at a final concentration of 10nM on Days 0 and 4 ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Molecular Biology 2023Quote: ... then the mixture was dialyzed against histone refolding buffer at 4 □ using a dialysis tube (D-TubeTM Dialyzer Medi or Maxi, MWCO 6-8 kDa, Merck). HE buffer (10 mM HEPES ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Genetics 2022Quote: ... 4 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−3 to 10−6) for transduction with 8 ng/μl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Neuroscience 2022Quote: ... for 5 min each at RT and incubated with secondary antibodies in TPBS-TS-1% for 4h at 4°C (Alexa Fluor 546 anti-Mouse (Merck, A-11018), Alexa Fluor 488 anti-goat (Abcam ...
-
bioRxiv - Biochemistry 2024Quote: ... Dissolved IntC-UbcH5c-CAET-Ub was transferred to a dialyzer (D-Tube Dialyzer Maxi, MWCO 6– 8 kDa, Merck) in 300 mL of unfolding buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... were applied for one hour at room temperature and cells were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck G8294; 1:3000) before mounting with Fluoromount™.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: OCT-embedded penis sections from humans and rats of 6-8 μm were cut in a cryostat and incubated with or without 4-Hydroxi-TEMPO (4-TEMPOL; Merck, Darmstadt, Germany) 10mM for 30 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... 9-β-D-Ribofuranosyladenine (adenosine) and (S)-(+)-a-amino-4-carboxy-2-methylbenzeneacetic acid (LY-367385) were purchased from Merck.
-
bioRxiv - Cell Biology 2023Quote: ... plates were treated with 3-amino-propyltrimethoxysilane (diluted 1:2 with PBS; Sigma-Aldrich/Merck) for 15min at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 µg/mL D-pantothenic acid (Merck, P5155), 1 µM rosiglitazone (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Plant Biology 2024Quote: ... 4-D (D7299, Sigma-Merck) 0.5mg/L were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Biochemistry 2023Quote: ... 5(6)-Carboxyfluorescein (CF) (Merck; 100 mM CF stock ...
-
bioRxiv - Molecular Biology 2020Quote: ... EmbryoMax KSOM medium with 1/2 amino acids without BSA (Reagent setup; Merck Millipore, cat. no. MR-107-D), BSA powder (Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2023Quote: ... VpALDH and SlAlaR were combined (each at 0.05 μM) with 1 U mL−1 D-amino acid oxidase (DAAO) from porcine kidney (Merck product no. A5222) and 2 U mL−1 catalase from bovine liver (Merck-MilliPoreSigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX ™ (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... from an 18500g centrifugation (6 min at +4°C) were run through 3-kDa cut-off centrifugal filters (Amicon Ultra-0.5 ml, Merck) into pre-weighted collection tubes to remove remaining macromolecules ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 1% non-essential amino acids (Merck) in a humidified incubator at 5% CO2 and 37 °C ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... 1 × Non-Essential amino acids (Merck, M7145), 1000⍰U/ml ESGRO®LIF (Merck ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% non-essential amino acids (Merck KGaA) and 10 mM HEPES buffer (Carl Roth) ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Immunology 2021Quote: ... either 4′,6-Diamidine-2′-phenylindole dihydrochloride (Merck) or LIVE/DEAD™ Fixable Near-IR stain kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); Dox-NP (300112 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Microbiology 2020Quote: ... One sterile 5-mm glass bead (Merck KGaA, Darmstadt, Germany) was placed into each well prior to incubation in 37 °C shaking condition (100 rpm ...
-
bioRxiv - Developmental Biology 2022Quote: ... 32.8 mM 20:4 and 60 mM 22:6) and pipetted dropwise into N2 media containing 3 mM fatty acid-free BSA (Merck, Cat. #A8806) at 37°C with constant stirring to obtain final concentrations of 3 mM 18:0 ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Genomics 2021Quote: ... serial 10-fold dilutions were prepared from the viral stock and used to transduce mESCs in a 6-well plate (Mock plus 10-2 to 10-6) together with 8 ng/µl polybrene (Merck) in duplicates ...
-
bioRxiv - Genetics 2021Quote: ... 5 serial 10-fold dilutions of the viral stock were applied to each well of a 6-well mESC plate (MOCK plus 10−2 to 10−6) for transduction with 8 ng/µl polybrene (Merck). Two replicates were generated for each well ...
-
bioRxiv - Physiology 2021Quote: ... Membranes blocked with 5% non-fat milk in PBS-T or Tris-Buffered Saline TBS (TBS-T) (RT, 60min) and immunoblotted using the following primary antibodies (4°C, overnight): rabbit anti-pSmad1/5/8 (Merck Millipore, AB3848), rabbit anti-pSmad2 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4′,6-diamidino-2-phenylindole (DAPI; Merck Life Science) 0.1 µg/mL was added to the medium to exclude dead cells.
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI) (Merck #10236276001) at a final concentration of 1 µg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... cells nuclei were stained with DAPI (4′,6-diamidino-2-fenilindol, 1:10000, Merck, cat#D9542) for 5 minutes at RT and mounted in Lab Vision™ PermaFluor™ Aqueous Mounting Medium (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then incubated with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; Merck Millipore) and mounted on slides with Mowiol (Merck Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% 100× MEM Non-essential Amino Acid Solution (Merck), 1% 250 μg/ml Amphotericin B (Merck) ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...