Labshake search
Citations for Merck :
251 - 300 of 2150 citations for 6 AMINO 3 HYDROXY PYRIDO 2 3 B PYRAZINE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...
-
bioRxiv - Microbiology 2022Quote: ... solvent B = acetonitrile with 0.1% formic acid (purity: MS-grade; Merck KGaA, Darmstadt, Germany), t (time)=0 min ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Genetics 2022Quote: ... they were treated with 200nM 4-hydroxy tamoxifen (Merck Millipore) to activate CreER recombination which results in cells becoming Δ/+ (fl/+ cells become Adar1 heterozygous ...
-
bioRxiv - Cell Biology 2022Quote: ... Standard minimal medium (SMM) consisted of 0.67% yeast nitrogen base without amino acids (Merck, product number Y0626), supplemented with all standard amino acids [bought from Sigma (now Merck)] at 76 mg/l except leucine ...
-
bioRxiv - Immunology 2023Quote: ... The Fmoc-derivatized amino acid monomers and the preloaded resins used as support were obtained from Merck. Once synthesized the peptides were cleaved from the resin with a standard scavenger-containing trifluoroacetic acid (TFA)-water cleavage solution and precipitated by addition to cold ether ...
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... resolubilized in 25 µL of 0.05% trifluoroacetic acid in 98:2 H2O/acetonitrile (v/v) and filtrated through a 0.2 µm spin filter (Merck Millipore Ultrafree®-MC ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with the nucleus DNA stain 4′,6-diamidino-2-phenylindole (DAPI) (1μg/ml D9542-10MG, Merck Life Science UK Ltd ...
-
bioRxiv - Cell Biology 2019Quote: ... acetylated α-tubulin (Clone 6-11B-1, Cell signalling Technology) or tyrosinated α-tubulin (Clone YL1/2, Merck Millipore) in blocking solution at 4 °C overnight ...
-
bioRxiv - Plant Biology 2024Quote: ... 2-(1H-Indol-3-yl)-4-oxo-4-phenyl-butyric acid (PEO-IAA; OlChemIm, Olomouc, Czech Republic) and indole-3-carbinol (I3C; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl T4 buffer and 2 µl 50% PEG4000 (Merck, Kenilworth, NJ). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µM epoxomicin and 50 µM (Z-LL)2-ketone (Merck Millipore) were added from stock solutions in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Biophysics 2022Quote: ... N-hydroxy-succinimide ester (0.1%w/v, Merck Chemicals GmbH, Germany) was added to the oil solution to functionalize the phantoms with Alexa 488 ...
-
bioRxiv - Cell Biology 2023Quote: ... overnight cultures were grown at 30 °C at 200 rpm in Yeast Nitrogen Base without amino acids (Merck) prepared according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 500 μg/mL rice-derived recombinant human albumin and 213 μg/mL L-ascorbic acid 2-phosphate (both from Merck). After 24 h of CHIR99021 stimulation ...
-
bioRxiv - Immunology 2021Quote: ... neuraminidase-specific inhibitor DANA was added to a final concentration of 100 μM (N-Acetyl-2,3-dehydro-2-deoxyneuraminic acid, Merck, USA). It was used for 48 h prior stimulus.
-
bioRxiv - Biochemistry 2023Quote: ... containing labeled or unlabeled glucose/glutamine and quenched by adding 50% ice-cold methanol containing 2 µg/mL cinnamic acid (Merck) as an internal control ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000) as liquid medium].
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000), either as liquid medium or supplemented with 2% Agar (Roth ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2% glucose (Merck) along with 2.5% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM CaCl2 (Merck) including sequencing grade trypsin (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Merck, Darmstadt, Germany).
-
bioRxiv - Cell Biology 2019Quote: ... 2% PFA (103999, Merck), 2.5% gluteraldehyde (11614 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% PFA (103999, Merck), 2.5% gluteraldehyde (11614 ...
-
bioRxiv - Immunology 2021Quote: ... + 2 μL H2O2 (Merck) in 20 mL citrate buffer ...