Labshake search
Citations for Merck :
1 - 50 of 4681 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... a volume of 1H,1H,2H,2H-perfluoro-1-octanol (PFO, Merck) is added to the emulsion with gentle pipetting used to break the emulsion ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 μL 1H,1H,2H,2H-perfluoro-1-octanol (Cat#370533-25G, Merck) was added into the emulsions and mixed gently until droplets were all de-emulsified ...
-
bioRxiv - Biophysics 2021Quote: ... Fusion was induced by surfactant replacement with 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) (PFO) ...
-
bioRxiv - Bioengineering 2024Quote: ... the emulsion was destabilized by adding the surfactant 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) on top of the buffer ...
-
bioRxiv - Developmental Biology 2022Quote: ... the channels where coated/treated with 1% (v/v) Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 (Fluorochem ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gels were subsequently demulsified with 45 µl 1H,1H,2H,2H Perfluoro 1 octanol (PFO) (Merck, #370533) into 200μl of MM+ Ri medium ...
-
bioRxiv - Cell Biology 2021Quote: ... Surfaces were functionalised by flooding the device with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500™ (3M™) ...
-
bioRxiv - Biochemistry 2024Quote: ... Diener Electronic) followed by channel surface functionalization using 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Merck) in HFE-7500™ (3M™ Novec™).
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Bioengineering 2021Quote: ... The master was passivated by vapor deposition of perfluorosilane (1H,1H,2H,2H-perfluorooctyl-trichlorosilane, Merck kGaA). Specifically ...
-
bioRxiv - Cell Biology 2023Quote: ... Silanization was performed by applying two drops of Trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Merck, 44893) onto a sheet of aluminium foil ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Bioengineering 2020Quote: ... the master was first placed in a vacuum desiccator beside a glass petri dish containing a droplet of trichloro(1H,1H,2H,2H-perfluorooctyl)-silane (Merck KGaA, Darmstadt, Germany), which subsequently coated the surface of the master with a hydrophobic layer allowing easy future peeling of the polydimethylsiloxane (PDMS ...
-
bioRxiv - Biochemistry 2023Quote: ... and 188 μM L-α-phosphatidylcholine: L-α-phosphatidylinositol PC:PI (3:1) (Merck, Darmstadt, DE). 1.5 ml of 0.1 M potassium phosphate buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: Zygotes were de-jellified using 3 % cysteine (Merck Millipore, USA), washed 6 times in N ...
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mL of Milli-Q® Water (Merck Milipore, DE) were added ...
-
bioRxiv - Immunology 2024Quote: ... and vinculin (1:5,000, V9131, Merck KGaA, DE) were mixed with LI-COR Intercept® PBS blocking buffer ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2h before clearing in benzyl alcohol:benzyl benzoate (1:2) (Sigma-Aldrich-Merck). Samples were stored in this solution at room temperature and protected from light.
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-α-Tubulin (1:5000, clone NDM1A, Merck, Darmstadt, DE). After incubation with HRP-coupled secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Systems Biology 2024Quote: ... (all Merck KGaA, Darmstadt, DE), 1µM AZD6244 ...
-
bioRxiv - Plant Biology 2023Quote: ... Authentic standard substances (Merck, DE) at varying concentrations were used for calibration and peak areas normalized to signals of the internal standard ((morpholino)-ethanesulfonic acid (MES) ...
-
bioRxiv - Biochemistry 2024Quote: ... 20% sucrose (Merck, Darmstadt, DE), 0.4 mg/ml lysozyme ...
-
bioRxiv - Microbiology 2024Quote: ... sourced from Merck (Darmstadt, DE). The plastics used were PP (CAS 9003-07-0) ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... cobalt chloride (100 µM, Merck, 1h-24h). Appropriate time matched controls were set for every treatment condition ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2020Quote: ... fixed in cold acetone (Merck, Darmstadt, DE) for 10 minutes and permeabilize with 0.4% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... After blocking for 2h in 10 % normal goat serum (NGS, Merck Millipore) and 0.5 % Triton (AppliChem ...
-
bioRxiv - Cancer Biology 2021Quote: ... EV peptides were de-salted using ZipTips (Merck) according to the manufacturer’s directions.
-
bioRxiv - Biochemistry 2020Quote: ... using a 100 kDa spin concentrator (Merck, DE). Next ...
-
bioRxiv - Biochemistry 2020Quote: ... using a 100 kDa spin concentrator (Merck, DE). Next ...
-
bioRxiv - Biochemistry 2023Quote: ... fatty acid (FA) free BSA (Merck, Darmstadt, DE) was added to a final concentration of 5% ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 mM KCl (7447-40-7, Merck, DE), 10 mM MgCl2 ...
-
bioRxiv - Biophysics 2024Quote: ... and all other chemicals from Merck (Darmstadt, DE). All electrolyte solutions used in bilayer experiments were buffered with 10 mM phosphate and filtered through 0.22 µm pore size PES vacuum filters from VWR International (Radnor ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by 2h incubation with Alexa Fluor-488 goat anti-rabbit IgG secondary antibody (1:500, A11008, Merck Millipore, MA). Slices were transferred to glass slides and covered with Fluoromount (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...