Labshake search
Citations for Merck :
1 - 50 of 5749 citations for 4' Trifluoromethoxy 5 trifluoromethyl 1 1' biphenyl 3 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... biphenyl (0.9) (Merck) and guaiacylglycerol-betaguaiacyl ether (GGE ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µM Trolox ([±]-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid; Merck), 100 µM nocodazole and 1 nM NAP (a gift from Illana Gozes ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Bioengineering 2022Quote: ... The space between the tip wall and the tubing was filled with 20 μL HFE-7500 containing 0.1% 008-Fluorosurfactant (RAN Biotechnologies) and 35% 1-bromo-3,5-bis(trifluoromethyl)benzene (Merck). Each PTFE tubing was threaded four times through the fluidic connector and fused to wider PE tubing (0.38 mm ID ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Birds from the anxiogenic group received 2.5 mg/kg of β-CCM (β-carboline-3-carboxylic acid-N-methylamide [FG 7142], Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) dissolved in DSMO (Dimethyl Sulfoxide suitable for HPLC ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Biophysics 2020Quote: ... Then His-tag containing OpuAC was introduced to the flow cell (in buffer B supplemented with 10 mM of (±)6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (Trolox; Merck) as a photostabilizer[20] ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Biophysics 2021Quote: ... and 1 % deoxycholic acid (Merck) in 50 mM Tris pH 8.0 ...
-
bioRxiv - Plant Biology 2020Quote: Inflorescences were harvested into fresh fixative (3:1 96% [v/v] ethanol [Merck] and glacial acetic acid) and kept overnight (O/N ...
-
bioRxiv - Microbiology 2022Quote: ... cells were fixed and permeabilized with a 3:1 mixture of methanol (Klinipath)-glacial acetic acid (Merck) for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX ™ (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... Lipoic Acid (LA, 1/1000, Merck), RPS6 (1/1000 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Neuroscience 2021Quote: ... a blocker of the sarco/endoplasmic reticulum Ca2+-ATPase pump (SERCA) and Carbonyl cyanide 4- (trifluoromethoxy) phenylhydrazone (FCCP, Merck-Sigma-Aldrich), a protonophoric uncoupler of mitochondrial oxidative phosphorylation that depolarizes the mitochondrial membrane and leads to the organelle’s release of calcium ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were stored at 4°C overnight before desilicification with 4% suprapure hydrofluoric acid (Merck; incubation of approximately 5 hours). Afterwards ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1 mM ethylenediaminetetraacetic acid (EDTA)) using an ultra-centrifugal filter (Amicon ultra-4 [30 kDa]; Merck). The (His)6-tag was cleaved by reacting with HRV3C overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... air-dried at RT for 30 min and fixed in Methanol:Acetic acid in a 3:1 ratio (Merck) at 4°C overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Plant Biology 2023Quote: Exogenous hormone treatments comprised 5 μM 1-napthaleneacetic acid (NAA; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Plant Biology 2024Quote: ... 1% acetic acid in H2O) containing an internal standard of 1 µM salicylic acid-d4 (SA-d4, Merck) was added ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... and 1-Naphthaleneacetic acid (NAA) (Merck, N0640) were dissolved in NaOH (1M ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 1% non-essential amino acids (Merck) in a humidified incubator at 5% CO2 and 37 °C ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... 1 × Non-Essential amino acids (Merck, M7145), 1000⍰U/ml ESGRO®LIF (Merck ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% non-essential amino acids (Merck KGaA) and 10 mM HEPES buffer (Carl Roth) ...
-
bioRxiv - Biophysics 2024Quote: ... 1% non-essential amino acids (Merck KGaA) and 10 mM HEPES buffer (Carl Roth) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Cell Biology 2022Quote: ... in 5% acetic acid (1.00063.1000; Merck). Membranes were blocked for 1 h at RT with 5% non-fat milk in PBS-T (1X PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5% formic acid (FA, Merck-Millipore) twice for 20 min ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Plant Biology 2021Quote: Starting reagents 3-hydroxybenzaldehyde 4 and hydrazine hydrate were purchased from Sigma-Aldrich and phenylacetic acid 1 was purchased from Merck. These reagents were used as received without further purification.
-
bioRxiv - Molecular Biology 2022Quote: ... or okadaic acid (1 µM, H2O) (Merck, Sigma) for 10 or 20 min in the absence of presence of insulin as indicated ...
-
bioRxiv - Cell Biology 2024Quote: ... vegetable oleic acid (18:1(n-9; Merck); 100 mg/ml ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Bioengineering 2021Quote: ... with 5 mM sulfuric acid (>99.5 %, Merck) as a mobile phase at 45 °C for ethanol ...
-
bioRxiv - Bioengineering 2020Quote: ... with 5 mM sulfuric acid (>99.5 %, Merck) as a mobile phase at 45 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... 5-hydroxyferulic acid (95%, Sigma-Aldrich Merck), sinapic acid (98% ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% 100× MEM Non-essential Amino Acid Solution (Merck), 1% 250 μg/ml Amphotericin B (Merck) ...
-
bioRxiv - Microbiology 2024Quote: ... and pyruvic acid (20 µg L−1; Merck, Germany) to supplement growth even during the continuous dark phases ...
-
bioRxiv - Physiology 2024Quote: ... 5 min incubation at room temperature with 100 µL 1-Bromo-3-chloropropane (BCP) (Merck, Darmstadt, Germany, #B9673) was performed ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... and pyridine (Merck, Germany, 9:3:1) in a GC vial for GC–mass selective detector non-cholesterol and oxysterol analysis ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 µM IWR-1 (I0161, Merck) with 20 µM Y27632 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...