Labshake search
Citations for Merck :
1 - 50 of 3376 citations for 3 2 5 Dimethylphenyl 4' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Microbiology 2024Quote: ... and 300 nM 4′,6′-diamidino-2-phenylindole (DAPI) (Merck, Germany; #28718-90-3). Fluorescence signals were observed by an ECLIPSE TE2000-U fluorescence microscope (Nikon ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 4-amino pyridine (5 mM, Merck) and TTX (0.5-1 μM ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Immunology 2024Quote: ... 2-DG (5 mM; Merck), DMM (10 mM ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL lipid extract was injected on a LiChroCART 250–4 LiChrospher® Si 60 (5 μm) (Merck) maintained at 25 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 500 μM of the protease inhibitor 4-(2-aminoethyl)-benzolsulfonyfluorid hydrochloride (BioChemica) and 5 U/mL-benzonase (Merck) were added (final concentrations) ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... Dried pellet was mixed with Lysis buffer (9M urea, 4 wt% CHAPS, 2% Pharmalyte carrier ampholyte pH 3-10, Merck) and left overnight at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: 5-bromo-2-deoxyuridine (BrdU) (Merck) immunofluorescence staining was performed to assess the influence of ECM stiffness on MCF10A proliferation ...
-
bioRxiv - Cell Biology 2023Quote: ... The blots were developed in a solution of nitroblue tetrazolium chloride (NBT) and 5-brom-4-chlor-3-indoxylphosphate (BCIP; Merck, Darmstadt, Germany) for 5–30 min at RT ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 2 μg/mL; Merck, Germany) for 1 h at RT ...
-
bioRxiv - Biochemistry 2022Quote: The matrix 2′,5′-dihydroxyacetophenone (DHAP; Merck) was applied by sublimation and the data were acquired on a modified timsTOF fleX instrument (Bruker Daltonics ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Immunology 2021Quote: ... either 4′,6-Diamidine-2′-phenylindole dihydrochloride (Merck) or LIVE/DEAD™ Fixable Near-IR stain kit (Invitrogen ...
-
bioRxiv - Bioengineering 2023Quote: ... 4′,6-Diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); Dox-NP (300112 ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Bioengineering 2024Quote: ... 4′,6-diamidine-2′-phenylindole dihydrochloride (10236276001, Merck); mouse anti-YAP (4912 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA oligonucleotide G4A4 (5’-AAAAAAGGGGAAAAGGGGAAAAGGGGAAAAGGGGAAAAAA-3’) was purchased from Merck. CD analysis of 2,5 µM RNA was carried out in the buffer used for G4-pulldown ...
-
bioRxiv - Neuroscience 2022Quote: ... was combined with 90μM sygRNA (5’ - GGATTTGGTAATAGCAG AGGGGG 3’) (Merck) at RT for 15 minutes to form an RNP complex ...
-
bioRxiv - Plant Biology 2021Quote: ... and half-strength phosphatase inhibitor cocktail 2 and 3 (Merck). Samples were clarified twice by centrifugation at 14 000 g ...
-
bioRxiv - Cell Biology 2023Quote: ... in 2× saline sodium citrate (SSC; Merck, 6132-04-3)) for 5 min at room temperature ...