Labshake search
Citations for Merck :
1 - 50 of 2661 citations for 3' 5' Dimethyl 2 morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2024Quote: ... Dimethyl 2-oxoglutarate (DM-OG) was purchased from Merck (cat no: 349631-5G) and added to the culture medium at 2mM and 4mM final concentrations.
-
bioRxiv - Microbiology 2023Quote: ... dimethyl sulfoxide (DMSO) (Merck), dimethylacetamide (DMAc ...
-
bioRxiv - Cell Biology 2021Quote: ... Differentiation of 4D7 and 2M12 cells was induced by 2% dimethyl sulfoxide (DMSO; Merck) for 48 hr ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... dimethyl sulfoxide (DMSO, Merck, 99.9%), phosphate buffered solution standard tablets (PBS ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 x 3’ Neoclear (Merck), 2 x 3 ‘ 100% ETOH ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Biophysics 2021Quote: ... Dimethyl-sulfoxide (DMSO) was from Merck. Peptide stock solutions were filtered using PVDF 0.22 µm syringe filters (Millipore Milex-HV ...
-
bioRxiv - Bioengineering 2021Quote: ... and 10% dimethyl sulfoxide (D2650, Merck) were defrosted at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... 60 ul of dimethyl sulfoxide (Merck) and 500 ul of YTB-PEG (100 mM LiOAc ...
-
bioRxiv - Biophysics 2024Quote: ... and 10% dimethyl sulfoxide (D2650, Merck). The fragments were then defrosted at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... 60 µl of dimethyl sulfoxide (Merck) and 500 µl of YTB-PEG (100 mM LiOAc ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Dimethyl-sulfoxide (DMSO) was purchased from Merck. Ultra-pure water was purchased from Biological Industries.
-
bioRxiv - Biophysics 2020Quote: ... Dimethyl-sulfoxide (DMSO) was purchased from Merck. Ultra-pure water was used for the entire study.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... dimethyl sulfoxide (DMSO) were acquired from Merck, Germany ...
-
bioRxiv - Microbiology 2022Quote: ... dissolved in 0.1% dimethyl sulfoxide (DMSO, Merck), or 0.1% DMSO alone ...
-
bioRxiv - Biochemistry 2022Quote: ... Dimethyl sulfoxide (DMSO) was purchased from Merck Limited ...
-
bioRxiv - Immunology 2024Quote: ... Dimethyl sulfoxide (DMSO) (cat. no. D8418, Merck) was used to prepare the STR stock solution and thus ...
-
bioRxiv - Neuroscience 2024Quote: PQ (1,1′-dimethyl-4,4′-bipyridinium dichloride; Merck) and DEM (diethyl (Z)-but-2-enedioate ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% (v/v) dimethyl sulfoxide (D2650, Merck), 0.1 mM 2-mercaptoethanol (198-15781 ...
-
bioRxiv - Immunology 2024Quote: ... 2-DG (5 mM; Merck), DMM (10 mM ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Plant Biology 2020Quote: ... Anti-Dimethyl Histone H3K9 antibody (Merck 05-1249), Anti-Trimethyl Histone H3K9 antibody (Merck 17-10242) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 10% dimethyl sulfoxide (DMSO; Merck, Darmstadt, Germany). After thawing ...
-
bioRxiv - Cell Biology 2023Quote: Chemicals were dissolved in dimethyl sulfoxide (DMSO) (Merck) or 96% ethanol (VWR ...
-
bioRxiv - Immunology 2022Quote: ... diluted in DMSO (Dimethyl sulfoxide, Merck, Darmstadt, germany) for 1 hour before addition of conditioned media of Untreated ...
-
bioRxiv - Cell Biology 2024Quote: Dimethyl Sulfoxide (DMSO) sterile (Merck, cat. no. D2650)
-
bioRxiv - Biochemistry 2024Quote: ... and cryopreserved in 10% DMSO (Dimethyl Sulfoxide) (Merck) in FCS (Fetal Calf Serum ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: 5-bromo-2-deoxyuridine (BrdU) (Merck) immunofluorescence staining was performed to assess the influence of ECM stiffness on MCF10A proliferation ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Cancer Biology 2021Quote: ... were solubilized in dimethyl sulfoxide (DMSO) (Merck, Darmstadt, Germany) to 10 mM stocks ...
-
bioRxiv - Bioengineering 2021Quote: ... cells were exposed to 20% dimethyl sulfoxide (DMSO, Merck) in cell culture media for 24 hours prior to performing the MTT assay ...
-
bioRxiv - Cell Biology 2021Quote: ... or DMSO (ref. D2660, dimethyl sulfoxide; Sigma-Merck, Argentina) for the times indicated in experiments ...
-
bioRxiv - Biophysics 2021Quote: ... then dissolved in traces of dimethyl sulfoxide (DMSO) (Merck) (<5 % ...