Labshake search
Citations for Merck :
4601 - 4650 of 4900 citations for 6 Bromo 3 phenyl imidazo 1 2 a pyridine 2 carboxylic acid methyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in T cell medium for 30 min at 37°C without any metabolic inhibitors or in presence of 1 μM oligomycin (Merck), 100 mM 2DG (Merck) ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies (table 1) were added in 5% milk TBS-T and membranes were developed using ECL luminol kit (Merck) and chemiluminescence films (Amersham Hyperfilm ECL ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...
-
bioRxiv - Neuroscience 2024Quote: ... or Tris-HCl buffered saline (TBS) and incubated at 4°C overnight with primary antibodies (anti-Nr4a2, Abcam, ab41917, 1:500 dilution; anti-GluA1, Merck-Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... the A549 cells were washed once with 1× phosphate-buffered saline (PBS) before incubating again with 100 µL of 0.5 mg/mL of MTT reagent (Merck, Germany) for 3 h at 37°C to allow the formation of purple formazan ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in RNA solubilization buffer (20 mM dithiothreitol (Vivantis, Malaysia) and 1 mM sodium citrate (Merck, Germany). The yield and purity were determined with a BioDrop Spectrophotometer Duo (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: ... and Pb external calibrations were prepared from 1 g/L stock solutions (Carl Roth, Centipur® Merck, or VHG Labs). Se was quantified by isotope dilution analysis (IDA ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions corresponding to CVB5 were combined and concentrated to 4.5 mg ml-1 using Amicon Ultra centrifugal filter units with 100 kDa MWCO (Merck Millipore).
-
bioRxiv - Neuroscience 2023Quote: ... Plates were washed three times with 0.1% PBST and incubated at RT for 1 hour with horseradish peroxidase-conjugated secondary antibody (Cat No. NA934, Merck Millipore) diluted 1:1,000 in 0.05% PBST ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Microbiology 2023Quote: ... binding of equine antibodies was detected by incubation for 1 hour with protein A conjugated to peroxidase (GE) and visualized with chemiluminescence reagent (ECL, Merck). Images were obtained with an Odyssey LI-COR instrument ...
-
bioRxiv - Cell Biology 2023Quote: ... APTS-labelled glycans were prepared for xCGE-LIF in a 1:10 dilution in water (water for chromatography, LC-MS grade, Merck) and mixed with 1 µl GeneScan™ 500 LIZ™ dye Size Standard (1:50 dilution in HiDi™ Formamide ...
-
bioRxiv - Biochemistry 2023Quote: ... Peak fractions were concentrated to 2.2 mg mL-1 using 100 kDa molecular weight cut-off centrifugal filters (Merck Millipore). To each 300-mesh holey carbon grid (Au R1.2/1.3 ...
-
bioRxiv - Evolutionary Biology 2023Quote: The frozen cell pellet was homogenized in RIPA buffer (Fujifilm, Osaka, Japan) containing 1/100 (v/v) in a final volume of Protease Inhibitor Cocktail (Merck) for 30 min at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Japan) in 1× PBS for 20 min at room temperature and then incubated with the anti-ADAR antibody HPA051519 (Merck) diluted 1:200 with PBS for 12 h at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... The pre-adipocytes were plated in custom-made plates (Supp. Fig. 15b) and cultured in growth medium -low glucose (1g l-1) DMEM (Merck) supplemented with 10% FBS (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C then moved to 37°C and incubated for 1 h with or without 100 µM cytochalasin D (Merck), 100 µM jasplakinolide (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Immunology 2023Quote: ... were transduced with respective CORA receptors in a multiplicities of infections (MOI) of 1 and 5 μg/mL Polybrene (Merck). Cells harboring the receptor were enriched by using biotinylated anti-EGFR antibody and anti-biotin microbeads (Miltenyi Biotec).
-
bioRxiv - Immunology 2023Quote: CORA receptors were transduced into a previously described Jurkat-based reporter cell line (12) by addition of lentiviral particles in a MOI of 1 and 5 μg/mL Polybrene (Merck) using spinoculation ...
-
Neural mechanisms underlying uninstructed orofacial movements during reward-based learning behaviorsbioRxiv - Neuroscience 2023Quote: ... the slices were washed three times with a blocking buffer containing 1% bovine serum albumin and 0.25% Triton-X in phosphate buffer saline (PBS) and then incubated with primary antibodies (anti-tyrosine hydroxylase, rabbit polyclonal, 1:1000, Merck Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... 1[µg of total RNA from each of three independent experiments was digested with DNase I (Merck Ltd. Budapest, Hungary) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then washed three times with 1 x PBS and mounted using an antifade mounting media (Sigma-Aldrich/Merck). The images were captured using a Zeiss AXIO Observer.Z1 Inverted Fluorescence microscope (Zeiss) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktail and 1 μM PARG inhibitor ADP-HPD (Merck). For chromatin fraction ...
-
bioRxiv - Biophysics 2023Quote: ... and was subsequently concentrated to 1 mL using a 100 kDa cut-off Amicon ultra centrifugal filter (Merck Millipore, Germany). The concentrated protein sample was further purified by size exclusion chromatography (SEC ...
-
bioRxiv - Developmental Biology 2023Quote: ... Haematoxylin and Eosin staining was performed on few ST muscle sections by incubating the slides at RT for 1 min in hematoxylin solution (Merck). Slides were then washed for 10 min in running tap water before incubating for 1 min in eosin solution (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then acquired on the flow cytometer for ~25 seconds before the addition of 1 μg/mL ionomycin (Merck), and calcium flux was measured for ~1.5 mins.
-
bioRxiv - Cell Biology 2023Quote: ... The pooled fractions were diluted with 2 vols of KPEM buffer to achieve a final concentration of 125 mM KCl and then incubated for 1 hr with 4 mL anti-FLAG monoclonal antibody conjugated resin (M2 agarose, Merck) using rolling ...
-
bioRxiv - Bioengineering 2023Quote: ... Then these samples were incubated in Alexa Fluor 488 conjugated mouse monoclonal anti-CTSK antibody (1:100) at 4°C overnight (Merck) and then for 1h under agitation at room temperature ...
-
bioRxiv - Developmental Biology 2022Quote: Organoids were washed with DPBS without calcium and magnesium and added to a 9:1 mixture of Accutase (Merck, A6954) and 10x Trypsin (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were dialyzed against 10 mM HEPES buffer (pH 7.2) containing 50 mM NaCl and 1 mM TCEP and concentrated using Amicon Ultra 100K (Merck Millipore) for electron microscopy analyses ...
-
bioRxiv - Microbiology 2023Quote: ... and a 1:500 dilution of an antibody against the phosphorylated form of H2A histone family member X (γH2Ax) (clone JBW301, Merck) and 1:200 phalloidin coupled to Alexa Fluor 568 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated overnight with an anti-GFP rabbit antibody (0.5 μg/ml) (Tamamaki et al., 2000) and an anti-Cre recombinase mouse monoclonal antibody (1:1,000; MAB3120, Merck Millipore). After a rinse ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM EDTA, 10 % (v/v) glycerol, 1% (w/v) digitonin (Carl Roth GmbH, Karlsruhe, Germany) and cOmplete protease inhibitor (Merck). Samples were rotated on a wheel for 1h ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryo and skin sections were then incubated with the primary antibodies overnight at 4°C (LHX2, 1:1000, #3030529 Merck, Darmstadt ...
-
bioRxiv - Neuroscience 2023Quote: ... in Tris- buffered salione containing 0.1% Tween-20 (v/v) (TBST) fore 60 mins at RT and incubated overnight with primary antibody against REST (1:500) (07-579, Merck), H3K9me2 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... fluorescent visualization of the nonisotopic signals used anti-digoxigenin antibodies conjugated to horseradish peroxidase (anti-digoxigenin-POD; Fab fragment; 1/200; Merck). This was followed by the deposition of biotin tyramide (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: Samples were resuspended in 6 μL 40% (v/v) 1-propanol with vortexing and bath sonication were applied to Silica Gel 60 aluminium-backed HPTLC plates (MERCK) (30 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cell pellet was resuspended in 400 μl of 40 μg/ml ultra-pure digitonin (Merck, CAS 11024-24-1) in vPBS and incubated (25 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... were mixed at a ratio of 4:1 based on monomer and injected onto a gel-filtration column (Superdex 200, 16/600, Merck) equilibrated in 20 mM HEPES buffer (pH 8.0) ...
-
bioRxiv - Pathology 2023Quote: Cryosections of formalin-fixed lung tissue 7 μm thick were washed in PBS and permeabilized for 1 h with 0.01% Tween 20 (Sigma-Merck, Germany), followed by three washes in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:10,000 WB) and mouse monoclonal antibody recognizing the N-terminus β-Actin (#A5441, 1:10,000 WB) were purchased from Merck. Rabbit polyclonal phosphomyosin (Thr18/Ser19 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were fixed using formaldehyde (1% V/V in H2O) for 10 min at RT before supplementation with 125 mM glycine solution (Merck) and agitation for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T cells harboring GFP-EBV BACmid cells were maintained complete DMEM supplemented with 1 mg/ml puromycin (Sigma-Aldrich/Merck). LCLs (LCL#1 and LCL#89) ...
-
bioRxiv - Microbiology 2023Quote: ... and peak integration was carried out with TraceFinder 4.1 software (Thermo Fischer Scientific) using confirmed retention times for 463 metabolites standardized with a library kit MSMLS-1EA (Merck). Peak smoothening was adjusted to 7 ...
-
bioRxiv - Developmental Biology 2024Quote: ... sequential semithin sections (1 um) were obtained and stained with a solution of 0.5% toluidine blue O (Merck, Darmstadt, Germany) for light microscopy to select cardiac regions comprising the atrioventricular canal and outflow tract ...