Labshake search
Citations for Merck :
401 - 450 of 5860 citations for Mono 3 Carboxypropyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... and DAPI (1 µg/mL, Merck) in blocking buffer for 4 h at 4 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 μl/ml benzonase (Merck)) for 15 min at room temperature under agitation ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 mg/mL streptavidin (Merck, Germany) is pipetted into the channel for 10 min incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg/mL bestatin (Merck, B8385), 100 U/ml RNase inhibitor (Thermo Scientific RiboLock) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 mL of chloroform (Merck Milipore) was added into each tube ...
-
bioRxiv - Genomics 2021Quote: ... mixed with 1 ml chloroform (Merck) and centrifuged for phase separation ...
-
bioRxiv - Genomics 2021Quote: ... 1 mg/mL proteinase K (Merck) and incubated at 55°C overnight ...
-
bioRxiv - Microbiology 2023Quote: 1 mL overnight autoinduction media (Merck) was used for the inoculation of single colonies obtained from the transformation ...
-
bioRxiv - Microbiology 2022Quote: ... and 1 U/ml benzonase (Merck). Cells were broken by sonication ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cystein (1 μg/ml, Merck), followed by mechanical trituration in medium supplemented with 10% fetal bovine serum (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... insulin (10 μg mL−1; Merck), 1 % penicillin/streptomycin (Merck) ...
-
bioRxiv - Biochemistry 2023Quote: ... resuspended in 8 mL lysis buffer (5 mM imidazole in 100 mM potassium phosphate buffer pH 8.0) supplemented with 1.25 g mL−1 of lyophilized lysozyme and 1 U mL−1 of benzonase nuclease (Merck Millipore), and lysed with an EmulsiFlex-B15 cell disruptor (Avestin) ...
-
bioRxiv - Neuroscience 2023Quote: ... The next day cells were split for selection on 400 μg/ml collagen-IV and 100 μg/ml fibronectin-coated (both from Merck) Transwell inserts (Corning ...
-
bioRxiv - Physiology 2022Quote: ... Metabolites were chromatographically separated in a SeQuant ZIC-cHILIC column (PEEK 100 x 2.1 mm, 3 μm particle size; Merck) at 30°C using a method consisting of a gradient running at 0.25 mL/min from 100% mobile phase B (9:1 acetonitrile:water containing 5 mM ammonium acetate pH 6.8 ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were incubated in primary antibodies solution (antibody diluted in PBS containing 3% goat serum, 0.01% Triton x-100 (Merck)) at 4°C over night ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were permeabilized with 0.1% Triton X-100 for 3 minutes and then blocked with 5 or 10% bovine serum albumin (BSA, Merck) in PBS for 20 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2021Quote: 2mL SARS-CoV-2 P4 supernatant containing 2 x 107 pfu/mL was purified using an Amicon Ultra column (MWCO 100kDa; Merck) by centrifugation and washing in PBS at 2,000 x g ...
-
bioRxiv - Cancer Biology 2020Quote: ... and further filtered to a final volume of 1 ml by repeated centrifugation (4000 × g, 4°C) using an Amicon Ultra-15 spin-filter unit (Merck Millipore, MWCO = 100 kDa). The sample was then loaded onto a 24 ml SEC column packed with sepharose CL-4B ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Immunology 2021Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... in absolute ethanol (Thermo-Fischer; order code AJA214-2.5LPL) and 3 mL of propionic acid (Merck, Pty Ltd. ...
-
bioRxiv - Microbiology 2022Quote: ... 3-10 mL of liquid culture was filtered through 0.2 um Polycarbonate (PC) membrane filters (Merck Millipore Ltd ...
-
bioRxiv - Immunology 2023Quote: ... Excess of chelator was removed by ultrafiltration (Amicon Ultra 0.5 ml, 3 kDa MWCO, Merck Millipore) using the same buffer conditions ...
-
bioRxiv - Bioengineering 2023Quote: Wild-type (WT/AB) embryos at 3 dpf were anaesthetised in 0.2 mg/ml MS222 (Merck) and mounted on 1.2 % w/v/ low-melting point agarose (Merck) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... Nitric acid 65%, N,N-dimethylformamide (DMF), sodium hydroxide (NaOH) and Ethylenediamine (EDA, ≥99 %) were purchased from Merck (Darmstadt, Germany). Dulbecco’s modified Eagle’s medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 mg ml−1 collagenase IV (Merck Millipore, C4-22) and 70 U ml−1 DNase (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1:100 protease inhibitor cocktail and 1 mM Phenylmethylsulfonyl Fluoride (PMSF; all from Merck). Equal amounts of protein (40 μg ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... with secondary antibodies diluted in blocking solution with 1% Hoechst 33258 (1:100, Merck). After three times washing with PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... concentrated to 6 mg/ml by a 100-kDa cut-off Centricon (Merck Millipore), and flash frozen for further cryo-EM grid preparation.
-
bioRxiv - Microbiology 2023Quote: ... followed by incubation at 37°C with 100 μg/mL cycloheximide (CHX; Sigma, Merck) and 18.4 μM PRM for 15 mins ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells were arrested in mitosis using either 100 ng/ml nocodazole (Merck, 487928) or 10 µM STLC (Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... these slides were treated with 100 μg/mL RNase A (type I-AS; Merck) in 1xSSC for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Then Advanced DMEM/F12 medium was added supplemented with 100 µg/ml cycloheximide (Merck) to stop new protein synthesis and organoids incubated for the indicated release times at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... onto fibronectin-coated fibronectin-coated plates (1:100, Merck, UK), in 300 µL of N2B27media ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were seeded onto fibronectin-coated plates (1:100, Merck) in DPBS during 1h at 37°C and grown in N2B27 media - to promote the differentiation of mESCs into a stage resembling the post-implantation epiblast ...
-
bioRxiv - Genomics 2021Quote: ... COL4 (dilution: 1:100, AB769, Merck Millipore, Billerica, MA, USA), AIF1 (dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse antibody against detyrosinated tubulin (1:100; MERCK, AB3201) each of which was diluted in blocking solution ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:100 diluted mAb anti-NeuN (Merck Millipore, MAB377, Germany) or 1:100 diluted pAb anti-CXCR3 at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... then stained with 1:100 cy5-coupled MPM2 (Merck/Millipore), treated with 0.2mg/ml RNAseA (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 μl chloroform/isoamyl alcohol (49:1) (Merck, #25668) were added ...
-
bioRxiv - Pathology 2023Quote: ... and anti-NeuN (1:100; MAB377, Merck, Billerica, MA, USA) antibodies were applied overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... and mouse anti-PSD95 (1:100; Merck-Millipore, Cat. #MAB1596). Astrocytic phagocytic activity and MEGF10 levels were characterized using sequential staining in order to minimize cross reactivity between mouse and rat antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... The strain was made ampicillin resistant by serial selections on Luria Broth (LB) agar (Carl Roth, Belgium) with increasing concentrations ampicillin (5 µL/mL to 100 µL/mL) (Merck, Belgium). Each time ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...