Labshake search
Citations for Merck :
401 - 450 of 1178 citations for 7 bromoquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Genomics 2020Quote: ... Free nucleic acids were then digested with 60 units/ml Benzonase Nuclease (Merck) for at least 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... we tried to contrast the lysis stimulation by contemporarily adding tranexamic acid (Merck) at a final concentration of 100 μM ...
-
bioRxiv - Neuroscience 2019Quote: ... The peptides were acidified to a total concentration of 1% Formic Acid (Merck). Samples were cleaned up using OASIS sample cleanup cartridges (Waters ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 g 2-(N-morpholino)ethanesulfonic acid (ULTRON grade, Merck KGaA, Darmstadt, Germany), and 5 g Gelrite (Duchefa) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The spectrum was collected after addition of 2,5-dihydroxybezoic acid matrix substance (Merck) using an UltrafleXtremeTM MALDI-TOF/TOF mass spectrometer (Bruker Daltonics ...
-
bioRxiv - Neuroscience 2021Quote: ... 10mM Hepes and 1% MEM amino acids (all obtained from Merck, Darmstadt, Germany). Cells were grown for two weeks ...
-
bioRxiv - Immunology 2020Quote: ... N’N’-tetramethyluronium-hexafluoro-phosphate (HBTU) and trifluoroacetic acid (TFA) were purchased from Merck Millipore (Merck KGaA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were split at 80% confluence using trypsin-ethylenediaminetetraacetic acid (trypsin EDTA; Merck), spun at 200 x g for 5 minutes to pellet and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and stop solution (0.16 M Sulfuric Acid (Merck cat. No. 7664-93-9)) were prepared in-house ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Glacial acetic acid and Acetonitrile used are of HPLC grade procured from Merck Millipore (Millipore Sigma ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... 400 µL of 1% 2-thiobarbituric acid (TBA; Merck, St. Charles, MO, USA), and 200 µL of 20% phosphoric acid and heated at 100 °C for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... and counterstained with modified Harris Hematoxylin (Epredia) differentiated with 1% acetic acid (Merck) for optimal stain intensity ...
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... formic acid and IPA in HPLC grade were purchased from Merck (Darmstadt, Germany). Purified water was produced by Elga Purelab Ultra (Celle ...
-
bioRxiv - Cell Biology 2023Quote: ... the pH of milk was adjusted to pH 4.6 by hydrochloric acid (Merck) followed by centrifugation at 4000×rpm (Beckman ...
-
bioRxiv - Microbiology 2023Quote: ... and the protein concentration was determined by bicinchoninic acid (BCA) assay (Merck Millipore) and by UV-visible spectroscopy using an ε of 24 mM⁻¹·cm⁻¹ at 280 nm ...
-
bioRxiv - Cell Biology 2023Quote: ... Released glycans were fluorescently labeled with 8-aminopyrene-1,3,6-trisulfonic acid (APTS, Merck). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 mM ascorbic acid) and filtered through a layer of Miracloth (Merck Millipore) for two times ...
-
bioRxiv - Neuroscience 2022Quote: 6-7 dpf zebrafish larvæ were deeply anesthetized using 0.2% Ethyl3-aminobenzoate methanesulfonate (MS222; Merck KGaA, Darmstadt, Germany) diluted in EM ...
-
bioRxiv - Immunology 2024Quote: ... ∼5,000 previously anti-dinitrophenyl (DNP) IgE-sensitized lung MCs (overnight at 1 µg/ml, clone SPE-7, Merck) were washed in Tyrode buffer (Merck ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... containing solid (7 g L−1 agar) full-strength Hoagland (2.75 mL well−1; pH adjusted to 6.5) (Sigma-Aldrich, Merck), sealed with parafilm and placed under the growth chamber ...
-
bioRxiv - Neuroscience 2023Quote: ... the two solutions were mixed in a 1:1 ratio and 7 drops of accelerator DMP-30 (45348, Merck) per 10 mL of Epon-mixture was added ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Bioengineering 2019Quote: ... molecular weight cut-off 3 kDa (Amicon®, Merck) to a concentration of 1 mg/mL as determined by Qubit Protein Assay Kit (Invitrogen™ ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated with Benzonase Nuclease (Merck Millipore, US170664-3) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 3-HA were purchased from Merck (Sigma-Aldrich). For L-kynurenine and kynurenic acid ...
-
bioRxiv - Genomics 2022Quote: ... and subsequently blocked in 3% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... using a 3 kDa MWCO Amicon centrifugal concentrator (Merck) and the N-terminal His6-tag cleaved with Human Rhinovirus 3C protease at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...