Labshake search
Citations for Merck :
401 - 450 of 1200 citations for 7 Propoxy 2H chromene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... stained with 0.057% Sulforhodamine B solution in 1% acetic acid (Merck, #230162) and washed twice with a 1% acetic acid solution in water ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Genomics 2020Quote: ... Free nucleic acids were then digested with 60 units/ml Benzonase Nuclease (Merck) for at least 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... we tried to contrast the lysis stimulation by contemporarily adding tranexamic acid (Merck) at a final concentration of 100 μM ...
-
bioRxiv - Neuroscience 2019Quote: ... The peptides were acidified to a total concentration of 1% Formic Acid (Merck). Samples were cleaned up using OASIS sample cleanup cartridges (Waters ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 g 2-(N-morpholino)ethanesulfonic acid (ULTRON grade, Merck KGaA, Darmstadt, Germany), and 5 g Gelrite (Duchefa) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The spectrum was collected after addition of 2,5-dihydroxybezoic acid matrix substance (Merck) using an UltrafleXtremeTM MALDI-TOF/TOF mass spectrometer (Bruker Daltonics ...
-
bioRxiv - Neuroscience 2021Quote: ... 10mM Hepes and 1% MEM amino acids (all obtained from Merck, Darmstadt, Germany). Cells were grown for two weeks ...
-
bioRxiv - Immunology 2020Quote: ... N’N’-tetramethyluronium-hexafluoro-phosphate (HBTU) and trifluoroacetic acid (TFA) were purchased from Merck Millipore (Merck KGaA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were split at 80% confluence using trypsin-ethylenediaminetetraacetic acid (trypsin EDTA; Merck), spun at 200 x g for 5 minutes to pellet and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and stop solution (0.16 M Sulfuric Acid (Merck cat. No. 7664-93-9)) were prepared in-house ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Glacial acetic acid and Acetonitrile used are of HPLC grade procured from Merck Millipore (Millipore Sigma ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... 400 µL of 1% 2-thiobarbituric acid (TBA; Merck, St. Charles, MO, USA), and 200 µL of 20% phosphoric acid and heated at 100 °C for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... and counterstained with modified Harris Hematoxylin (Epredia) differentiated with 1% acetic acid (Merck) for optimal stain intensity ...
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... formic acid and IPA in HPLC grade were purchased from Merck (Darmstadt, Germany). Purified water was produced by Elga Purelab Ultra (Celle ...
-
bioRxiv - Cell Biology 2023Quote: ... the pH of milk was adjusted to pH 4.6 by hydrochloric acid (Merck) followed by centrifugation at 4000×rpm (Beckman ...
-
bioRxiv - Microbiology 2023Quote: ... and the protein concentration was determined by bicinchoninic acid (BCA) assay (Merck Millipore) and by UV-visible spectroscopy using an ε of 24 mM⁻¹·cm⁻¹ at 280 nm ...
-
bioRxiv - Cell Biology 2023Quote: ... Released glycans were fluorescently labeled with 8-aminopyrene-1,3,6-trisulfonic acid (APTS, Merck). Briefly ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 mM ascorbic acid) and filtered through a layer of Miracloth (Merck Millipore) for two times ...
-
bioRxiv - Neuroscience 2022Quote: 6-7 dpf zebrafish larvæ were deeply anesthetized using 0.2% Ethyl3-aminobenzoate methanesulfonate (MS222; Merck KGaA, Darmstadt, Germany) diluted in EM ...
-
bioRxiv - Immunology 2024Quote: ... ∼5,000 previously anti-dinitrophenyl (DNP) IgE-sensitized lung MCs (overnight at 1 µg/ml, clone SPE-7, Merck) were washed in Tyrode buffer (Merck ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.