Labshake search
Citations for Merck :
401 - 450 of 5762 citations for 7 BROMO 2 3 4 5 TETRAHYDRO 1H BENZO E 1 4 DIAZEPINE 2 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... equipped with a LiChrospher® 100 RP-18 (125 mm x 4 mm, 5 µm) C18 reversed-phase column (Merck). The elution solvents consisted of ultrapure water with 0.1% formic acid (A ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated overnight at 4°C with mEM48 (1:500, Merck Millipore, Cat. # MAB5374) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated overnight at 4 °C with primary antibodies (GSX2: rabbit 1:200, Merck-Millipore ABN162 ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies were applied overnight at 4°C (monoclonal anti–IdU 1:4000; SAB3701448, Merck). Sections were incubated in biotinylated secondary antibodies (Jackson ImmunoResearch Labs ...
-
bioRxiv - Microbiology 2020Quote: ... 48 and 72 hours) of exposure to simulated solar radiation was performed by using 2’,7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma Aldrich-Merck KGaA, Darmstadtm Germany) solubilized in ethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5 mL of a UPLC-grade water:methanol (3:1, v/v) solution with 1:500 diluted 13C-and 15N-labeled amino acids standard mix (Sigma-Aldrich, Merck, Darmstadt, Germany) was added to the tubes ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM 2-mercaptoethanol) supplemented with a protease inhibitor cocktail (cOmplete, Sigma-Aldrich/Merck). Cell extracts were injected into a Ni Sepharose column for affinity chromatography purification followed by size exclusion chromatography of the RnlA-mutant–containing fractions as a final step ...
-
bioRxiv - Immunology 2020Quote: 2-5.105 cells were incubated for 2 h with different concentrations of H2O2 (Merck) or for 2 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/well of overlay [MEM containing 2% FBS and 0.4% tragacanth (Merck, Israel)] was added to each well and plates were incubated at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Cell Biology 2022Quote: Metaphase II-arrested eggs (at least 4 hours after polar body extrusion) were treated for 4 hours with: Cytochalasin D (C8273-1MG, Merck) at a final concentration of 5 μg/ml in M2 medium or Latrunculin B (428020-1MG ...
-
bioRxiv - Biophysics 2024Quote: ... Germany) for 4 h at 4°C followed by a washing in 0.1 M Soerensen’s Phosphate Buffer (Merck, Darmstadt, Germany). The dehydrating step was performed in the ascending alcohol series with 10 minutes duration each ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... rat slices were exposed to 3 μM dihydroethidium (DHE) while in humans’ sections it was added 4 μM DHE (Merck, Darmstadt, Germany) for 30 minutes at 37ºC 51 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x phosphatase inhibitor 2 (Merck) and 1x phosphatase inhibitor 3 (Merck) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli Rosetta 2 cells (Merck) by induction with 0.2 mM isopropyl β-d-1-thiogalactopyranoside for 18 h at 18 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... coli Rosetta 2 (DE3) (Merck) and purified using Glutathione Sepharose High Performance beads (GE Healthacare ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mM glutamine (Sigma, Merck) and 1% penicillin-streptomycin (Pen-Strep ...
-
bioRxiv - Cell Biology 2021Quote: ... L-glutamine (2 mM; Merck), β-mercaptoethanol (50 µM ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg/ml U18666A (Merck) or vehicle (DMSO only ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitor cocktail–2 (Merck) at 1% (v/v) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 CaCl2 (Merck KGaA) at pH 7.4 ...
-
bioRxiv - Neuroscience 2020Quote: ... WO-2 MABN10 (Merck Millipore). Membranes were washed ...
-
bioRxiv - Cell Biology 2021Quote: ... Dithiothreitol (DTT; 2 mM; Merck). The lysate was cleared by centrifugation (18 000 g for 8 min at 4 °C) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl Benzonase (Merck-Millipore) and sonicated for 45 min (intervals ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM CaCl2 (A862982, Merck), 1 mM MgCl2 ...
-
bioRxiv - Immunology 2023Quote: ... and 2 units thrombin (Merck)/mg SCT protein previously measured by mouse-IgG-Fc-based sandwich ELISA following an overnight incubation at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 mM EDTA (Merck). Isolated cells were passed through a 70 μm cell strainer (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2023Quote: ... 2 mM MgCl2 (1.05833.0250, Merck), 1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mM CaCl2 (Merck; 1023780500), 1 mM MgCl2 (Merck ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2 mM L-glutamine (Merck), 5 μg/ml human insulin (Merck) ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 µM ubiquinone-2 (Merck) and 0.01-0.05 µM RC-LH1 in a buffer mixture containing 50 mM Tris ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Cell Biology 2021Quote: ... then post-fixed in 4% PFA (Merck, 8187081000) at room temperature for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... using RP select B 125-4 Column (Merck). The chromatography was carried out at a flow rate of 1.5ml/min starting with a mobile phase of 80% methanol and 20% H2O for 3 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were fixed with 4% PFA (Merck, #104005) in PBS at room temperature for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... and 0.1 μL Benonase (9025-65-4, Merck) was added to each 1 mL of crude virus extract to remove cell genome and plasmid DNA ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 4 mL of chloroform (Merck Millipore) and mixing ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were then fixed in 4% PFA (Merck) and immunostained with mouse monoclonal anti-SARM1 primary antibody (Chen et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 4% PFA (Merck or Sigma-Aldrich). The brains were collected and fixed overnight in 4% PFA in PBS at 4°C ...
-
bioRxiv - Immunology 2020Quote: Cryosections were fixed with 4% paraformaldehyde (PFA, Merck) and stained with primary and fluorescent-labeled secondary antibodies as described (Figel et al. ...
-
bioRxiv - Genomics 2020Quote: ... filters were fixed with 4% paraformaldehyde (PFA, Merck) and permeabilized with 0.1% Triton X-100 (Merck) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 4% paraformaldehyde (Merck, Whitehouse Station, USA) in 0.1 M PBS ...