Labshake search
Citations for Merck :
4151 - 4200 of 4386 citations for Rat Dynamin 1 Like Protein DNM1L ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... followed by incubation in LI-COR blocking buffer containing rabbit polyclonal anti-P2X2 (#APR-003, Alomone labs; 1:2000) and mouse anti-Na+/K+-ATPase (05-369; EMD Merck Millipore) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... pooled and concentrated to roughly 0.5 – 1 mL by ultrafiltration spin units Amicon® Ultra–15 10 kDa MWCO (Merck-Millipore). Buffer was exchanged against storage buffer (40 mM Hepes (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The binding of CoVHH1-FLAG to S1 subunits-His tag was detected by incubating for 1 hour at room temperature with mouse monoclonal ANTI-FLAG® M2-Peroxidase (Merck) diluted with PBST ...
-
bioRxiv - Neuroscience 2021Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Biochemistry 2021Quote: FLAG-CAHS1 was constructed using standard genetic engineering techniques with an N-terminal FLAG using a pT7-FLAG-1 vector (Sigma-Aldrich, Merck). The bacterial cells of E ...
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 10 kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were then incubated for 1 hour with a species-appropriate HRP-conjugated secondary antibody (diluted 1:5000 in TBST) before bands were visualised using Immobilon Forte Western HRP Substrate (Merck Millipore). Primary antibodies used were mouse anti-αSMA (Dako ...
-
bioRxiv - Cell Biology 2019Quote: ... Total β1-integrin was detected by immunoblotting the membrane again with clone N29 anti-β1-integrin antibody (Merck, MAB2252, 1:1000) and appropriate secondary antibody and analysis on the Odyssey (LI-COR ...
-
bioRxiv - Immunology 2019Quote: ... and mouse monoclonal anti-DNA/Histona H1 antibody (1:100; catalog number 05-457/clone AE-4; Merck Millipore, MA, EUA). Alternatively ...
-
bioRxiv - Genomics 2019Quote: ... ChIP was performed on this chromatin extract using 1 µL of Anti-acetyl-Histone H4 (Lys16) Antibody (Merck Milipore, 07-329) or 0.5 µL of Histone H3 antibody mAb MABI 0301 (Active Motif ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000, MAB5406, Merck Millipore) or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were then incubated overnight at 4°C in blocking solution containing one of the following primary antibodies: anti-GFAP (1:2000; Merck Millipore) and anti-Iba1 (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... PfCERLI1HAGlmS parasites were transfected with the an episomal cytosolic GFP expressing plasmid pHGBrHrBl-1/2 and maintenance of this plasmid was selected for using 5 μg/mL blasticidin-S-deaminase HCl (Merck Millipore). Maintenance of the SLI-TGD plasmid was selected for using 20 μM WR99210 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lipids were resuspended in a small volume of chloroform/methanol (2:1) and applied to a to HPTLC plate (Silica Gel 60, Merck, Germany) together with DOPC/cholesterol and NeuGc/NeuAc GM3 as standards ...
-
bioRxiv - Physiology 2021Quote: ... Resulting lipid films were dissolved in 1 mL of n-hexane containing a C19:0 as internal standard (1.03 μg mL−1, CAS number 1731-94-8, Merck, Darmstadt, Germany) with addition of 200 μL of a solution of potassium hydroxide (KOH ...
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 10 μL were spotted into reverse-phase TLC (RP-TLC) plates (silica gel 60, RP-18, F254s, 1 mm, Merck, Germany). The plates were developed in chambers pre-saturated for 10 min using acetone as a solvent system ...
-
bioRxiv - Cell Biology 2020Quote: ... All supernatant was removed using a 1 ml syringe and the beads were resuspended in 30 μl 2X SDS Sample Buffer (Merck Millipore). The samples were incubated at 98°C for 5 minutes before electrophoresis.
-
bioRxiv - Biochemistry 2021Quote: ... with 0.1% (w/v) RapiGestTM SF surfactant (Waters, UK) and protease inhibitors (Roche cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail, Merck, UK).
-
bioRxiv - Neuroscience 2021Quote: ... fixed with a 4% PFA solution and stained for tyrosine hydroxylase (TH; rabbit anti-TH, 1:1000, Cat#: 657012, Merck Millipore) and neurobiotin (Streptavidin Alexa Fluor conjugate 647 ...
-
bioRxiv - Systems Biology 2021Quote: ... A volume of 1 mL supernatant was transferred to an LC glass vial using Millex-HV PVDF syringe filter tips (Merck Millipore). The HPLC column (Aminex 300-mm HPX-87H ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was removed with a 1 ml syringe and the beads were resuspended in 30 μl 2X SDS Sample Buffer (Merck Millipore). The samples were incubated at 98°C for 5 min and the samples were posteriorly collected by centrifuging for 5 minutes at 16000 xg.
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2021Quote: ... weighed and then dissociated using scissors in 1.2 mL of digestion media containing 1 mg/mL collagenase D (Merck Life Sciences) and 0.1 mg/mL DNase I (Merck Life Sciences ...
-
bioRxiv - Molecular Biology 2021Quote: Xist expression was driven by a TetOn promoter induced by addition of 1 µg/mL of doxycycline (Merck Life Science, D9891). Prior to experiments ...
-
bioRxiv - Immunology 2022Quote: Cells were lysed by addition of a mild lysis buffer containing 1% octyl-β,D-glucopyranoside (#O9882-500MG, Sigma-Aldrich, Merck), 0.25% sodium deoxycholate (#1065040250 ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were placed in fresh buffer PBS-T-milk for 1h (or 1h30 when performing the LTAs western blot in parallel) with the polyclonal rabbit anti-PBP2B antibody (at 1:5000, lab. stock or available at Merck ABS2199), the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... and additional wells with 20% biotinylated PLL-g-PEG and FNIII(7-10) were supplemented with 1 µM staurosporine (Merck Millipore) to serve as a positive control for apoptosis ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Cell Biology 2022Quote: ... pre- equilibrated with PBS) and were concentrated to 1 mg/mL using a 10-kDa cutoff Amicon Ultracell Centrifuge Filter Unit (Merck, UFC5010BK), and stored at 4°C in the dark.
-
bioRxiv - Evolutionary Biology 2022Quote: ... the experiments were performed in 96-wells plates containing 100 μL of MM (with 1% agar) supplemented or not with 3mM of H2O2 (Merck S.A) or 0.15mM of menadione (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2022Quote: ... 20S proteasome activity as well as reactive oxygen species production, 300 µl Tris-Buffered Saline (TBS, pH 7.6) and 1% Triton X-100 (Merck, Darmstadt, Germany) were added to a tissue powder aliquot and homogenization was performed using ten consecutive passages through a 24-gauge needle on ice ...
-
bioRxiv - Physiology 2022Quote: ... To generate protein homogenates suitable for western blot analysis, 300 µl Tris-Buffered Saline (TBS, pH 7.6) + 1% Triton X-100 (Merck, Darmstadt, Germany) supplemented with 1x Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast of cell line BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) was grown in 1 litre of YPD (yeast extract (Merck/Sigma-Aldrich cat. no. 70161), peptone (Merck/Sigma-Aldrich cat ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4°C with primary antibodies against AVP neurophysin II (NP-II; MERCK, MABN845, PS41; 1:200); OXT NP-I (PS38 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were incubated with a BG4-Flag antibody (1:100 diluted in 0.5% goat serum + PBST, MABE917, Merck, Darmstadt, Germany) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The pre-cleared lysates were then incubated overnight at 4°C with polyclonal rabbit anti-TipR antibodies (1:400 dilution) (Kirkpatrick and Viollier, 2014) or monoclonal rabbit anti-HA antibodies (1:250 dilution) (Clone 114-2C-7, Merck Millipore). ...
-
bioRxiv - Neuroscience 2022Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... slices were incubated for 24-48h at 4°C with mouse anti-Neurophysin I (1:2000, Merck Millipore, marker for Oxytocin), rabbit anti-vasopressin (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... in 100µl of binding/wash buffer supplemented with protease inhibitor with protease inhibitor cocktail Set I-Calbiochem 1:100 (Cat# 539131, Merck Millipore) and phosphatase inhibitors ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...