Labshake search
Citations for Merck :
4101 - 4150 of 4431 citations for 6 Bromo 3 4 dihydro 2H 1 benzopyran 3 methanamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... coli NA2232 grown in a M9 minimal medium supplemented with 2g/L of 13C-D-glucose (Cortecnec, France) and 1 g/L of 14N-ammonium chloride (Merck) as sole carbon and nitrogen sources ...
-
bioRxiv - Microbiology 2020Quote: ... and the pellet of 1 mL lysed with Bug Buster (pellet sample) (Bug Buster® Master Mix, Novagen® Merck). For lysis ...
-
bioRxiv - Biochemistry 2021Quote: ... Lipids containing [6-3H]GlcN-PI were dissolved in 100 μL of chloroform: methanol (2:1, by volume) and loaded to a high performance thin-layer chromatography (HPTLC) plate (Merck). The [6-3H]GlcN-PI was located by phosphorimaging ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human melanoma cell lines WM35 and WM793B were cultured in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution (Merck, Darmstadt, Germany). For generation of conditioned melanoma media for immune cell inhibition experiments tryptophan (Merck ...
-
bioRxiv - Immunology 2020Quote: ... After washing and incubation with unbuffered DMEM containing 25 mM D-Glucose (Carl Roth, Karlsruhe, Germany) and 1 mM Pyruvate (Merck) for 1h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... A was 1 mM ammonium formate pH 9 (for lincomycin detection, prepared by titration of formic acid 98–100%, Merck, Germany with ammonium hydroxide 28–30% ...
-
bioRxiv - Plant Biology 2021Quote: ... Each MS medium was made by adding 1 bag of MS salt mix (Nihon pharmaceutical CO., LTD.) into the proper volume of milli-Q (Merck) water ...
-
bioRxiv - Microbiology 2019Quote: Standards of selected metabolites (Supplementary Table 1) were prepared at 10 µM in 80% acetonitrile (Hypergrade for LCMS LiChrosolv, Merck) and injected separately into a column connected to mass spectrometer interface ...
-
bioRxiv - Microbiology 2019Quote: ... 1) were cultivated according to species-specific cultivation requirements on tryptic soy agar (TSA, ReadyPlate TSA ISO, Merck Life Science) or Middlebrook agar produced in-house ...
-
bioRxiv - Immunology 2020Quote: ... The sections were blocked in PBS containing 1% bovine serum albumin (BSA) for 1 h at RT and stained in blocking buffer containing primary antibody (anti-PP6C, Merck Millipore cat ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with mouse monoclonal Alexa Fluor-488 conjugated antibody against NeuN (1:200, MAB377X, Merck Millipore, MA, USA) or the rabbit polyclonal primary antibody against DISC1 (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated 1h at RT in a blocking buffer (20% BR + 20% goat serum) and then overnight with an anti-DIG-AP antibody (1:2000, Merck) in the blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1-oleoyl-2-acetyl-sn-glycerol (OAG) and 4α-phorbol 12,13-didecanoate (4α-PDD) were obtained from Merck (Gillingham, UK). Sphingosine-1-phosphate (S1P ...
-
bioRxiv - Neuroscience 2021Quote: ... MDMi cells were incubated with a primary antibody against Iba1 (1:1,000; 019-19744, FUJIFILM Wako Chemicals) in blocking buffer (2% bovine serum albumin, 0.1% TritonX100 (Merck, Darmstadt, Germany), and 5% normal donkey serum (017-000-121 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was eluted from the filter with 2 x 50 µl of Elution Buffer and 1 x 50 µl with DEPC-treated Molecular Biology Grade water (Merck). RNA samples were quantified with NanoDrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with MISSION® SiRNA oligomers or MISSION® siRNA Universal Negative Control #1 (Sigma Aldrich, Merck, USA) at a final concentration 20 nM ...
-
bioRxiv - Biochemistry 2022Quote: ... lysates were incubated with anti-HA agarose beads (20 μl of beads per 1 mg of proteins) (Merck, Darmstadt, Germany) for 2 h ...
-
bioRxiv - Immunology 2022Quote: Decidual cells were isolated as described above and incubated in the presence of fluorescence-labeled latex beads (50 beads per cell; latex beads, 1 µm, carboxylate-modified polystyrene, fluorescent yellow-green, Merck) for 2 hours at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were blocked for 30 min in 0.3 % Triton / 10 % normal goat serum / TBS followed by overnight primary antibody incubation (1:1000; rb TH; Merck Millipore) at 4 °C ...
-
bioRxiv - Genetics 2022Quote: ... Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001, Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... individuals were placed in 0.008% alizarin red (alizarin red S monohydrate, Waldeck Chemie, Münster, Germany) and 1% potassium hydroxide (EMSURE, Merck, Darmstadt, Germany) for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... the sections were treated with 10% methanol in PB for 20 min and then incubated for 1 h at RT in incubation buffer: 5% normal donkey serum (NDS: Merck) and 0.2% Triton X-100 (Merck ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL of filtered protein extract was mixed with 40μL of anti-FLAG M2 magnetic beads (Merck, formerly Sigma-Aldrich) (equilibrated in GTEN + 0.1 % Tween-20 prior to use ...
-
bioRxiv - Neuroscience 2022Quote: ... The dura was removed and a glass pipette connected to a Hamilton syringe containing LPC (1% in PBS; Merck, Germany) was lowered into the brain until 1.80 mm depth from the brain surface reaching into corpus callosum ...
-
bioRxiv - Molecular Biology 2022Quote: ... was assessed before and after induction with Doxycycline (1 μg/mL) by Western blot analysis using an anti-FANCJ (cat. B1310, Merck) and/or an anti-Flag antibody.
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Microbiology 2022Quote: ... wells were washed twice with warm PBS before incubation in 500 μL pre- warmed DMEM with 1% (v/v) Nutridoma (Merck) supplemented with 5 μM clickable sphingosine (Cayman Chemical ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1% BSA/PBS and subjected to the Click-iT reaction in a solution containing 10 mM sodium ascorbate (Merck), 0.1 mM azide-PEG3-biotin conjugate (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... FOs were sonicated 2 x 10 sec in ice-cold 1:2 methanol/chloroform solvent containing SPLASH LIPIDOMIX MS standard internal standard mix (Merck). 1:6 H2O was added to the samples before shaking at 1000 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... the amiloride-sensitive component (amilmax) was determined by adding 10 µM amiloride to the apical compartment or ouabain (1 mM, # O3125, Merck) to the basolateral chamber to calculate the maximal ouabain-sensitive Na,K-ATPase activity (ouabmax).
-
bioRxiv - Microbiology 2024Quote: ... from the resin was immediately neutralized with 1/10 faction volume of 1 M Tris-HCl pH 8.5 and concentrated using an Amicon Ultra-2 Centrifugal Filter Unit 100kDa NWMCO (Merck Millipore), in which the elution buffer was exchanged with PBS (GIBCO).
-
bioRxiv - Cell Biology 2024Quote: Samples were resuspended in 6 μL 40% (v/v) 1-propanol with vortexing and bath sonication were applied to Silica Gel 60 aluminium-backed HPTLC plates (MERCK) (30 ...
-
bioRxiv - Cell Biology 2024Quote: ... the cell pellet was resuspended in 400 μl of 40 μg/ml ultra-pure digitonin (Merck, CAS 11024-24-1) in vPBS and incubated (25 min ...
-
bioRxiv - Microbiology 2023Quote: ... and peak integration was carried out with TraceFinder 4.1 software (Thermo Fischer Scientific) using confirmed retention times for 463 metabolites standardized with a library kit MSMLS-1EA (Merck). Peak smoothening was adjusted to 7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U mL−1 benzonase (Merck). After 1 h incubation at 37 °C ...
-
Insight into the regulatory mechanism of the MFS transporter, SCO4121 by the MarR regulator, SCO4122bioRxiv - Molecular Biology 2024Quote: ... the MSA agar plate was flooded and 500 µg/ml of nalidixic acid (Himedia) and 1 mg/ml of apramycin (Merck). After incubation ...
-
bioRxiv - Developmental Biology 2024Quote: ... sequential semithin sections (1 um) were obtained and stained with a solution of 0.5% toluidine blue O (Merck, Darmstadt, Germany) for light microscopy to select cardiac regions comprising the atrioventricular canal and outflow tract ...
-
bioRxiv - Cell Biology 2024Quote: ... and Pb external calibrations were prepared from 1 g/L stock solutions (Carl Roth, Centipur® Merck, or VHG Labs). Se was quantified by isotope dilution analysis (IDA ...
-
bioRxiv - Microbiology 2024Quote: ... the A549 cells were washed once with 1× phosphate-buffered saline (PBS) before incubating again with 100 µL of 0.5 mg/mL of MTT reagent (Merck, Germany) for 3 h at 37°C to allow the formation of purple formazan ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in RNA solubilization buffer (20 mM dithiothreitol (Vivantis, Malaysia) and 1 mM sodium citrate (Merck, Germany). The yield and purity were determined with a BioDrop Spectrophotometer Duo (Biochrom ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lyophilized peptides were resolubilized in 80 % acetone with 1 % TFA and loaded onto an ihouse ZIC-HILIC micro-column containing 30 mg of ZIC-HILIC particles (Merck Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies (table 1) were added in 5% milk TBS-T and membranes were developed using ECL luminol kit (Merck) and chemiluminescence films (Amersham Hyperfilm ECL ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w) ratio using GeneJuice transfecting agent (Sigma-Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in T cell medium for 30 min at 37°C without any metabolic inhibitors or in presence of 1 μM oligomycin (Merck), 100 mM 2DG (Merck) ...
-
bioRxiv - Systems Biology 2023Quote: ... UK), eosin Y 1% alcoholic and xylene (CellPath, UK), periodic-acid (TCS Biosciences Ltd, UK) and Schiff’s reagent (Merck, Germany). Description of the IF and IHC antibodies used can be found in the Supporting Information.