Labshake search
Citations for Merck :
351 - 400 of 1777 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by embedding in 5 % low melting agarose (Merck). Gelatinated blocks were washed in 0.1 M Soerensen’s phosphate buffer (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% (v/v) Donkey serum (Merck Millipore, S30-100ML) for more than 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
bioRxiv - Genetics 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mg/mL Triton X-100 (Merck, X100). Solubilisation was carried at 4 °C for 20 min with mild agitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% CO2 in MEM (Merck Life science UK limited) with 10% FBS ...
-
bioRxiv - Microbiology 2019Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
Efficient breeding of industrial brewing yeast strains using CRISPR/Cas9-aided mating-type switchingbioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Gefitinib (Y0001813, Merck; used at 5 μM final concentration), SCH772984 (S7101 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-incubated for 30 minutes in 5% BSA (Merck) in PBS containing 0.05% Tween-20 (PBST) ...
-
bioRxiv - Systems Biology 2020Quote: ... blocked with 5% bovine serum albumin (BSA, Merck, #821006) and 0.3% Triton X-100 (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5% normal donkey serum (Merck Millipore S30-100mL). After that ...
-
bioRxiv - Pathology 2022Quote: ... per mouse) and for 5 minutes with liberase (MERCK, cat ...
-
bioRxiv - Systems Biology 2022Quote: ... or 5 mM TCEP (Merck Sigma, Cat. No. C4706) and incubated for 1 hour or 30 min at 37°C or 56°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μm SeQuant ZIC-pHILIC column (Merck, VIC, Australia), with a 20 × 2.1 mm SeQuant ZIC-pHILIC guard column was used ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 g/L sodium chloride (Merck, S3014-1kg). Following overnight growth ...
-
bioRxiv - Immunology 2019Quote: ... pre-coated with fibronectin (5 μg/ml, Merck Millipore) for evaluation of NDTRs ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μm and 0.22 μm filters (142 mm, Merck). Filters with 5 μm and 0.22 μm pore size were stored immediately on dry ice on board and at –80°C in the laboratory until further processing ...
-
bioRxiv - Molecular Biology 2021Quote: ... or with 5 μg/ml α-amanitin (Merck, A2263) as indicated in the text.
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with 5 μg/ml Hoechst (Merck). Images were taken at 630-fold magnification on a Leica DM 5000B microscope with a Leica DFC 300 FX camera ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteasomal degradation inhibitor: MG132 (5 – 50 µM, Merck KgaA); cathepsin inhibitors ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 mg/mL α-casein (Merck, Darmstadt, Germany) (7 ...
-
bioRxiv - Microbiology 2022Quote: ... Nuclei were stained with 5 µg/ml Hoechst (Merck) in PBS for 30 min.
-
bioRxiv - Biophysics 2022Quote: ... membrane-impermeant Cy®5 Mono NHS Ester (Merck / Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 µg/mL Heparin (MERCK, Cat. no. H3149-25KU), 1X N2 Supplement ...
-
bioRxiv - Microbiology 2022Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at ambient temperature 55 °C and analyzed samples were eluted with 5 mM H2SO4 in water at flow rate of 0.3 mL/min.
-
bioRxiv - Cancer Biology 2022Quote: ... Blocking was completed via incubation with 5% BSA (Merck) solution for 1 hour followed by overnight incubation at 4°C with 1:100 dilutions of DNA labelled anti-P2Y2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and blocked with 5% goat sera (Merck, Darmstadt, Germany) in PBST with for one hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... obtained from filtration through a 5-μm filter (Merck), and then to drain spent medium into the waste bottle ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% CO2 in RPMI-1640-sodium bicarbonate medium (Merck), supplemented with 10% bovine calf serum (GE Healthcare HyClone ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 µl of 5 mg/ml DNase (Merck, 10104159001) and 100 µl of 2.5% trypsin-EDTA (Life Technologies ...
-
bioRxiv - Biophysics 2023Quote: Sodium chloride (NaCl, Merck, cat. no. 7647-14-5)
-
bioRxiv - Evolutionary Biology 2023Quote: ... 5 mM EDTA (all chemicals purchased from Merck Millipore) and Halt™ Protease Inhibitor cocktail (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% DMSO (Cat. No. D5879; Sigma-Aldrich, Merck, Germany) and 0.01% sodium azide (NaN3 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1mM sodium pyruvate and 5 µg/ml insulin (Merck)) and B27 media (Neurobasal supplemented with 1X B27 and 2mM L-Glutamine (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 mg lysostaphin (Sigma-Aldrich, Merck, Darmstadt, Germany) and incubated for 1 h at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with 5 μM etoposide (Merck; E1383) for 4h for the immunofluorescence assay ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µg dephosphorylated myelin basic protein (Merck, 13-110), and purified MAK protein ...
-
bioRxiv - Microbiology 2024Quote: ... xylene and absolute ethanol (Merck, CAS-64-17-5) for 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... were coated overnight with 5 ug/cm2 fibronectin (Merck). hAMECs were seeded at a density of 40k cells per well while hCMECs ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with insulin 5 μg/ml (Merck, I6634-250MG), hydrocortisone 1 μg/ml (Voden ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 μM Rotenone and Antimycin (R/A) (Merck). Mitochondrial respiration was measured using a Seahorse Xfe96 Analyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μM latrunculin A (LatA) (catalog no. L5163, Merck) with 50 nM trichostatin A (TSA ...