Labshake search
Citations for Merck :
351 - 400 of 4111 citations for 7 Bromo 2 3 dihydro isoindol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SC consisted of 0.7% yeast nitrogen base (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Physiology 2023Quote: ... Embryos were dehydrated in one hour intervals in an ascending tetrahydrofuran (THF, Merck, Darmstadt, Germany) series (50% THF ...
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Biophysics 2021Quote: ... for 1 min in O2 plasma and incubating them with fibronectin (2 μg/mL) (Merck, Darmstadt, Germany) in 100 mM NaHCO3 (pH 8.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... vigorously vortexed for 1 min and leukocytes retrieved by centrifugation were fixed using 2 % paraformaldehyde (Merck #158127) on ice for 10 min and washed with PBS-0.1 % sodium azide solution.
-
bioRxiv - Cancer Biology 2022Quote: ... Phophorylated MEK was detected using anti-phospho MEK 1/2 (residues 218/222 and 222/226, MERCK, catalogue No ...
-
bioRxiv - Biophysics 2019Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Immunology 2023Quote: ... were premixed at a 1:9 molar ratio or a 2:98 molar ratio in chloroform (Merck) to arrive at PLBs harboring Ni-DOGS-NTA at 10% or 2% ...
-
bioRxiv - Developmental Biology 2023Quote: ... gastruloids were incubated with secondary antibodies and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4°C overnight ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.43 mM MgCl2) with the addition of 0.2 mM 1-phenyl-2-thiourea (PTU, Merck, Germany) to block pigmentation ...
-
bioRxiv - Cell Biology 2023Quote: ... and fertilized eggs were cultured in EmbryoMax KSOM Medium (1X) w/ 1/2 Amino Acids (Merck Millipore) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lipids were dissolved in chloroform:methanol (2:1, v:v) and separated by TLC on silica gel 60 (Merck) along with a standard ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...