Labshake search
Citations for Merck :
351 - 400 of 5298 citations for 7 Amino 8 oxo 3 cis prop 1 enyl 5 thia 1 azabicyclo 4.2.0 oct 2 ene 2 carboxylic acid diphenylmethyl ester hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2020Quote: ... nucleic acids were digested by addition of 1 µL benzonase (Merck KGaA) and 10 µL 1 M MgSO4 followed by incubation at room temperature for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... and 1 mM ethylendiamine tetraacetic acid (EDTA) (#EDS-100G, Sigma-Aldrich, Merck) in Ca/Mg-free PBS (#14190-169 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Gamma-aminobutyric acid (GABA, rabbit, 1:300, Sigma, Merck, Germany, A2052); anti-Green Fluorescent Protein (GFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... stained with 0.057% Sulforhodamine B solution in 1% acetic acid (Merck, #230162) and washed twice with a 1% acetic acid solution in water ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in PBS and incubated for 2 min in 2 mM H2O2 (Merck) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... or 2-deoxy-glucose (2-DG; 500 μg/g) (25972, Merck Life Sciences) were injected IP at Day 0 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Biochemistry 2020Quote: ... Tryptic peptides were successively extracted with 5 % formic acid (Merck)/50 % acetonitrile (Merck) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a mid-filter of 5 μm pore size (Mixed cellulose ester membrane filter; Merck Millipore, USA) and finally through a 0.22 μm collection filter (Cellulose mixed ester membrane filter ...
-
Observation of an α-synuclein liquid droplet state and its maturation into Lewy body-like assembliesbioRxiv - Molecular Biology 2020Quote: ... and 10 mM levamisole hydrochloride (Merck) on a glass-bottom imaging dish (MatTek P35G-1.5-14-C) ...
-
bioRxiv - Genetics 2023Quote: ... L-Carnitine hydrochloride (Merck, C0283-5G), and acetic acid (Fisher ...
-
bioRxiv - Microbiology 2022Quote: ... The sections were then incubated overnight in PBS with 0.2% BSA and 0.05% Tween-20 with primary antibodies directed against SARS-CoV-2 Nucleocapsid Protein (1:500; mouse monoclonal, # ZMS1075, Merck); Iba1 (1 ...
-
bioRxiv - Cell Biology 2019Quote: ... acetylated α-tubulin (Clone 6-11B-1, Cell signalling Technology) or tyrosinated α-tubulin (Clone YL1/2, Merck Millipore) in blocking solution at 4 °C overnight ...
-
bioRxiv - Immunology 2022Quote: ... samples were re-loaded four times before washing with 1 mL of 2% acetonitrile (ACN) (#1000292500, Sigma-Aldrich, Merck) in 0.2% acetic acid ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Lipid II extract was assessed by spotting 1-2 μL on a HPTLC silica gel 60F254 plate (Merck). The TLC plate was developed in a mixture of chloroform:methanol:water:ammonia (88:48:10:1 ...
-
bioRxiv - Plant Biology 2022Quote: ... the CDS of wild type (WT) PpGS1b.1 and PpGS1b.2 were subcloned into pET30a vector (Merck, Darmstadt, Germany) including a N-terminal 6xHis-tag by PCR ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were washed trice for 10 min with 0.05% Tergitol in TBS (Tris-Buffered Saline) and blocked for 1 hour with 2% BSA (Merck) in TBS ...
-
bioRxiv - Cell Biology 2023Quote: ... specimens were post-fixed for 2 h at RT in 1% osmium tetroxide in 0.05 M cacodylate buffer pH 7.4 (Merck, Germany) and dehydrated stepwise in a graded ethanol series followed by 100% acetone ...
-
bioRxiv - Cell Biology 2024Quote: ... medium—composed of 6.7 g Yeast Nitrogen Base without amino acids (Difco 291940) and 0.8 g complete supplement mixture drop-out (Formedium DCS0019) in 1 L—supplemented with 2% glucose (Merck). Cells from glycerol stocks or agar plates were inoculated into YPD and incubated at 30°C on an orbital shaker at 250 rpm (in an Innova 4230 incubator ...
-
bioRxiv - Bioengineering 2022Quote: ... that was recently established by a disruption of both AAH1 and APT1.18 Yeast strains were grown overnight at 30 °C in a synthetic defined SD medium (6.7g/L Yeast Nitrogen Base without Amino Acids (Difco) and 20g/L glucose (Merck)) containing a specific mixture of amino acids and nucleobases ...
-
bioRxiv - Plant Biology 2020Quote: ... tumefaciens were resuspended in 50 mM MES (2-Morpholinoethanesulfonic acid hydrate) (Duchefa, Haarlem, The Netherlands) - KOH buffer (pH 5.6) containing 2mM NaH2PO4 (Merck, Darmstadt, Germany), 100 µM acetosyringone (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich, 95904). Reaction mixtures were mixed by gently tapping the Eppendorf ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on manufacturer-suggested minimum seeding density) with lenti/retroviral supernatant in a 1:1 volumetric ratio and 8 µg/mL hexadimethrine bromide (Merck), before centrifugation at 900g for 30 min and returning to incubation at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2020Quote: ... 48 and 72 hours) of exposure to simulated solar radiation was performed by using 2’,7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma Aldrich-Merck KGaA, Darmstadtm Germany) solubilized in ethanol ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM 2-mercaptoethanol) supplemented with a protease inhibitor cocktail (cOmplete, Sigma-Aldrich/Merck). Cell extracts were injected into a Ni Sepharose column for affinity chromatography purification followed by size exclusion chromatography of the RnlA-mutant–containing fractions as a final step ...
-
bioRxiv - Immunology 2020Quote: 2-5.105 cells were incubated for 2 h with different concentrations of H2O2 (Merck) or for 2 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/well of overlay [MEM containing 2% FBS and 0.4% tragacanth (Merck, Israel)] was added to each well and plates were incubated at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x phosphatase inhibitor 2 (Merck) and 1x phosphatase inhibitor 3 (Merck) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli Rosetta 2 cells (Merck) by induction with 0.2 mM isopropyl β-d-1-thiogalactopyranoside for 18 h at 18 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... coli Rosetta 2 (DE3) (Merck) and purified using Glutathione Sepharose High Performance beads (GE Healthacare ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mM glutamine (Sigma, Merck) and 1% penicillin-streptomycin (Pen-Strep ...
-
bioRxiv - Cell Biology 2021Quote: ... L-glutamine (2 mM; Merck), β-mercaptoethanol (50 µM ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg/ml U18666A (Merck) or vehicle (DMSO only ...
-
bioRxiv - Cell Biology 2020Quote: ... phosphatase inhibitor cocktail–2 (Merck) at 1% (v/v) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 CaCl2 (Merck KGaA) at pH 7.4 ...
-
bioRxiv - Neuroscience 2020Quote: ... WO-2 MABN10 (Merck Millipore). Membranes were washed ...
-
bioRxiv - Cell Biology 2021Quote: ... Dithiothreitol (DTT; 2 mM; Merck). The lysate was cleared by centrifugation (18 000 g for 8 min at 4 °C) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl Benzonase (Merck-Millipore) and sonicated for 45 min (intervals ...