Labshake search
Citations for Merck :
351 - 400 of 4362 citations for 6H Furo 3 2 d 1 3 dioxin 6 one 4a ethoxytetrahydro 2 2 dimethyl 4aR 7aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM Cu2SO4 and 0.1mM biotin-azide (Merck, 762024) or AlexaFluor 647 azide (Thermo Fisher ...
-
bioRxiv - Biophysics 2020Quote: 18) Sodium hydroxide (NaOH, Merck, CAS # 1310-73-2)
-
bioRxiv - Cancer Biology 2022Quote: ... 0.05 mM 2-mercaptoethanol (pH 7.2; Merck, Kilsyth, Australia), 60 µg/mL penicillin (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.05 mM 2-mercaptoethanol (pH 7.2; Merck, Kilsyth, Australia), 60 µg/mL penicillin (Life Technologies) ...
-
bioRxiv - Microbiology 2022Quote: ... and 2 μl benzonase (Merck-Millipore, Burlington, MA, USA) were added to the homogenate ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 2% foetal bovine serum (FBS, Merck, Germany), pen/strep and amphotericin B.
-
bioRxiv - Plant Biology 2022Quote: ... and 0.15gr Iodine crystals (Merck, CAS-7553-56-2) dissolved in 50 mL distilled water ...
-
bioRxiv - Developmental Biology 2023Quote: ... and oriented by embedding in 2 % methylcellulose (Merck, Germany) on the glass slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 2 mg/kg Diphtheria toxin (DT) (Merck, Sigma) dissolved in 100 µL of saline ...
-
bioRxiv - Microbiology 2023Quote: ... Tyrosol [2-(4-hydroxyphenyl) ethanol] (Merck Ltd., Budapest, Hungary) was prepared as a 0.1 M stock solution in sterile physiological saline.
-
bioRxiv - Cell Biology 2022Quote: ... 2 mmol/L sodium dihydrogen phosphate (NaH2PO4; Merck, #71507) and 50 μg/mL L-ascorbic acid (Carl Roth ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mM antibiotics (penicillin and streptomycin) solution (Merck, #P4333), and 2 mM L-glutamine (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... 20 ng/mL fibroblast growth factor 2 (Merck Millipore), and 10 ng/mL epidermal growth factor (Merck Millipore) ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml CaCl2 (2.5 M; Merck; Catalog Cat.nr. 1023820500) and 12 ml of ddH2O were slowly added (5 ml/15 cm plate ...
-
bioRxiv - Genetics 2024Quote: ... fixed for 20 min 2% paraformaldehyde (Merck Life Science) and for 30 min in 75% ethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM Glutamax (gibco) and 10 mM nicotinamide (Merck). After 24 days ...
-
bioRxiv - Immunology 2024Quote: ... Each construct was transformed into BL21 Rosetta 2 (Merck) and grown in LB at 30 °C ...
-
bioRxiv - Immunology 2020Quote: Survival was determined by assessing the fraction of vital cells at defined time points during culture by flow cytometric exclusion of 4’,6-Diamidin-2-phenylindol (DAPI) (Merck, Darmstadt, Germany) and Annexin V-APC (BD Biosciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell-free samples were fixed for 1 hour at room temperature with 2% glutaraldehyde (Merck) in 0.1M cacodylate buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti tyrosinated-α-tubulin 1:250 (MAB1864-I, clone YL1/2, EMD Millipore/Merck), mouse anti-Armadillo/β-Catenin 1:50 (N27A1 ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 200µM of 1-phenyl-2-thiourea (PTU, ref. n°P7629, Merck/Sigma-Aldrich) to avoid pigmentation ...
-
bioRxiv - Plant Biology 2021Quote: ... 14-3-3 binding was detected using anti-GST monoclonal antibody (Merck).
-
bioRxiv - Molecular Biology 2023Quote: ... exponentially growing RPE-1 cells were pulse-labeled with 1 μM CldU (5-Chloro-2’-deoxyuridine, Merck, C6891) and 250 μM IdU (5-Iodo-2’-deoxyuridine ...
-
bioRxiv - Cell Biology 2019Quote: ... Rac1/3 (23A8, Merck), Rac2 [6] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3% hydrogen peroxide (Merck) was applied to the sections prior to incubation with HRP-conjugated secondary antibodies for 1h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-Alexa647-Azide (Jena Bioscience ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Microbiology 2022Quote: ... supplied with 2 ml of staining buffer (Lou et al., 2020) composed of PBS with 2% Fetal calf serum (FBS (Merck, Kenilworth, New Jersey, USA), and fixated with 250 µlBD Cytofix™ (BD Biosciences ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed and resuspended in PBS and measured by flow cytometry (FACS) using the Guava Easy Cyte 6-2 L system (Merck Millipore, Schwalbach, Germany). Fluorescence was excited at 488nm and BODIPY emission was recorded at 530 and 585 nm ...
-
bioRxiv - Molecular Biology 2021Quote: ... Apoptotic cell death was detected by annexin-V/propidium iodide staining and subsequent flow cytometry analysis using the Guava Easy Cyte 6-2 L system (Merck Millipore, Schwalbach, Germany). Annexin-V-FITC emission was detected with the green filter at 525/530 nm ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293Tcells were incubated with 2 µg/ml Nocodazole (Merck# M1404) for 15min prior to lysis with the same buffer containing Nocodazole and no paclitaxel.
-
bioRxiv - Biochemistry 2019Quote: ... and 2 mM TCEP) containing EDTA-free protease inhibitor (Merck), and lysed by sonication ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 mM MgCl2 and 25U/ml Benzonase (# 70746, Merck Millipore). Lysates were resolved on 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels (#4561096 ...
-
bioRxiv - Biophysics 2021Quote: ... Blebbistatin (B0560, Merck; used at 2 μg/ml final concentration), Gefitinib (Y0001813 ...
-
bioRxiv - Neuroscience 2020Quote: ... using a Millicell ERS-2 Electrical Resistance System (Merck-Millipore). To calculate transendothelial electrical resistance (TEER ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-ERK1/2 (Millipore, Merck Life Science S.L.U., Portugal), rabbit anti-phosphorylated ERK1/2 (Thr202/Tyr204 Erk1 and Thr185/Tyr187 Erk2 ...
-
bioRxiv - Plant Biology 2020Quote: DSF (cis-11-methyl-2-dodecenonic) was purchased from Merck and dissolved in DMSO to obtain 100 mM stock ...
-
bioRxiv - Microbiology 2020Quote: ... 2-Propanol and hydrochloric acid (HCl) were purchased from Merck, India ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 mM MgCl2] followed by DNA digestion using Benzonase (Merck). Equal amounts of total protein was loaded on NuPAGE Bis-Tris (4-12% ...
-
bioRxiv - Biophysics 2022Quote: ... Saos-2 cells were transiently transfected using GeneJuice (Merck/Novagen).
-
bioRxiv - Cell Biology 2022Quote: ... 0.2 μM microcystin-LR and 10 mM 2-chloroacetamide (Merck) as described previously 37 ...
-
bioRxiv - Microbiology 2021Quote: ... then 2 µm (Isopore, 47 mm; Merck Millipore, Cork, Ireland), and finally 0.22 µm (Isopore ...
-
bioRxiv - Systems Biology 2022Quote: ... anti-cysteine sulfenic acid 2-thiodimedone (ABS30, Merck, Darmstadt, Germany), living colors mouse anti-GFP (632681 ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were then selected with puromycin (2 µg/ml; Merck). Resistant cells were sorted after TROP2 induction with DOX (final concentration 2 µg/ml ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... supplemented with benzonase (2 μl of 10000 U/μl, Merck), Protease Inhibitor Cocktail (Set III ...