Labshake search
Citations for Merck :
351 - 400 of 4155 citations for 6 PHENYL 1 3 DIHYDRO INDOL 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: In vitro treatments were carried out with different compounds: 1 μM MG-132 24 hours or 3 hours (Merck Millipore), 20 μM Chloroquine (CQ ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374, used at 1:10,000 for the Western blot analyses, Merck Millipore); a rabbit anti-LC3B polyclonal antibody (#2775 ...
-
bioRxiv - Biochemistry 2021Quote: ... were transformed into Escherichia coli BL21-DE3-pLysS and expressed in 3 x 1 litre of Lucia Broth medium (Merck) supplemented with 100µg/ml ampicillin (Formedium) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 2 ml 4 °C PBS for 3 times and afterwards fixed in 1 ml of −20 °C cold methanol (Gradient grade for liquid chromatography, Merck) for 5 minutes at −20 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Product number E4250) (1 mg/ml) to contract pigment cells alongside 0.01% Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich (Merck) Product number E10521 ...
-
bioRxiv - Cell Biology 2023Quote: ... reagent (chlortrimethylsilane [Merck KGaA, Darmstadt, Germany]/1.1.1.3.3.3-Hexamethyldisilasane [Sigma Aldrich, Co., St. Louis, MO, U.S.A]/pyridine [Merck KGaA, Darmstadt, Germany], 9:3:1) in a GC vial for GC-MS-SIM non-cholesterol analysis ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were concentrated to an A260ml−1 of 3 (100 nM) using an Amicon Ultra 0.5 ml spin column with a 100 kDa cutoff (Merck Millipore) to an OD260 absorbance of 5.0.
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... Prior to protein quantification milk was diluted 1:2 in assay buffer (Merck-Millipore, Burlington, USA). Concentrations for 15 cytokines (IL-1α ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were 12 x serially diluted 1:2 in a 96-well plate (Merck, Darmstadt, Germany) starting with 4000 cells in the first column ...
-
bioRxiv - Neuroscience 2023Quote: ... Finally, clearing was performed in BABB (benzyl alcohol:benzyl benzoate 1:2, (Merck 8187011000 and Sigma 108006) for 48h.
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Biophysics 2021Quote: ... anti-6×His and anti-FLAG M2 (Sigma-Aldrich, Merck, USA). The anti-mouse IgG ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were then postfixed with 0.8% K3Fe(CN)6 (Merck), 1% OsO4 (Serva ...
-
bioRxiv - Immunology 2019Quote: ... the inhibitor 6-amino-4–4-phenoxyphenylethylamino-quinazoline (Merck Millipore, USA) was reconstituted in DMSO at a stock concentration of 1mM and administered at a final concentration of 10nM on Days 0 and 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 μM of mitochondrial pyruvate transporter inhibitor UK9055 (Merck, cat. 5048170001) were added to test if mitochondria have the capacity to utilize other substrates than pyruvate ...
-
bioRxiv - Immunology 2023Quote: ... Transfections were carried out in 6 well plates using GeneJuice (Merck) with 1 μg of plasmid DNA per well ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting product was cloned into a pBAC-6 vector (Merck) by In-Fusion cloning (Clontech) ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SC consisted of 0.7% yeast nitrogen base (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Physiology 2023Quote: ... Embryos were dehydrated in one hour intervals in an ascending tetrahydrofuran (THF, Merck, Darmstadt, Germany) series (50% THF ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Biophysics 2021Quote: ... for 1 min in O2 plasma and incubating them with fibronectin (2 μg/mL) (Merck, Darmstadt, Germany) in 100 mM NaHCO3 (pH 8.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... vigorously vortexed for 1 min and leukocytes retrieved by centrifugation were fixed using 2 % paraformaldehyde (Merck #158127) on ice for 10 min and washed with PBS-0.1 % sodium azide solution.
-
bioRxiv - Cancer Biology 2022Quote: ... Phophorylated MEK was detected using anti-phospho MEK 1/2 (residues 218/222 and 222/226, MERCK, catalogue No ...
-
bioRxiv - Immunology 2023Quote: ... were premixed at a 1:9 molar ratio or a 2:98 molar ratio in chloroform (Merck) to arrive at PLBs harboring Ni-DOGS-NTA at 10% or 2% ...
-
bioRxiv - Cell Biology 2023Quote: ... and fertilized eggs were cultured in EmbryoMax KSOM Medium (1X) w/ 1/2 Amino Acids (Merck Millipore) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lipids were dissolved in chloroform:methanol (2:1, v:v) and separated by TLC on silica gel 60 (Merck) along with a standard ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Plant Biology 2021Quote: ... 20 μl 40 mM glucose-6-phosphate (Sigma-Aldrich, now Merck KGaA) and 20 μl 35 mM NADP+ (KMF OptiChem ...