Labshake search
Citations for Merck :
351 - 400 of 3870 citations for 3 1H Pyrrol 1 yl phenyl methanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Neuroscience 2024Quote: ACS was prepared from astrocyte cultures with aNSPC medium and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243 to obtain a < 3 kDa and a > 3 kDa fraction ...
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Plant Biology 2024Quote: ... protoplasts were treated with 3 µM DAPI (Merck) overnight ...
-
bioRxiv - Microbiology 2024Quote: ... 3 rounds of phenol-chloroform-isoamyl alcohol (Merck) extraction were performed using 15 ml gel-lock tubes (QIAGEN) ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP (1:2000) (Faix et al., 2001) or mouse monoclonal antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000; #CB1001-500UG, Merck (Darmstadt, Germany)) and anti-fascin antibody 5E2 (undiluted hybridoma supernatant) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the slides were rinsed three times with PBS and blocked for 1 hour at RT in blocking buffer made with 3% BSA (Merck Millipore, 0218072801) and 0.02% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... was dissolved in vehicle (Ringer solution; NaCl 140 mM, CaCl21.2 mM, KCl 3 mM and MgCl2 1 mM (Merck KGaA Darmstadt, Germany)) to a dilution of 5.5μg/μl ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2024Quote: ... The medium was then collected and filtered with a 3 kDa filter (Amicon Ultra-4 centrifugal Filter 3 kDa MWCO, Merck UFC8003243). Five distinct preparations of ACS <3kDa were prepared from five astrocytes cultures and were then sent to the Protein Analysis Facility of the University of Lausanne for Mass Spectrometry analysis.
-
bioRxiv - Neuroscience 2024Quote: ... The AAV titer was quantified usizg PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein solution was centrifuged at 16,000 g for 30 minutes with a 3 kD cut-off filter (Amicon Ultra Centrifugal Filter, 3 kDa MWCO, Merck Millipore) to remove previous buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... The tissue sections from the in vivo experiment were incubated with a rabbit primary antibody for GluR2/3 (Merck Millipore; AB1506; 1:200) overnight and then with a secondary goat anti-rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2023Quote: ... The sections were then incubated for 1 h with 700 µL of a 10% (v/v) DMSO/3% (v/v) IGEPAL® CA-630 (Merck, Darmstadt, Germany) in MTSB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The following day the membrane was washed with T-PBS (0.1% tween) (15 min x 3 times) and appropriate secondary antibody: (i) anti-rabbit antibody conjugated with peroxidase enzyme (Merck Sigma, Burlington, MA) was dissolved in 5% BSA in T-PBS (0.1% tween ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated with Benzonase Nuclease (Merck Millipore, US170664-3) for 30 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 3-HA were purchased from Merck (Sigma-Aldrich). For L-kynurenine and kynurenic acid ...
-
bioRxiv - Genomics 2022Quote: ... and subsequently blocked in 3% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... using a 3 kDa MWCO Amicon centrifugal concentrator (Merck) and the N-terminal His6-tag cleaved with Human Rhinovirus 3C protease at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Immunology 2021Quote: ... Cloning of the antigen library into the T7 phages was performed following manufacturer’s instructions (T7Select 10-3 cloning kit, catalog no. 70550-3, Merck-Millipore, Burlington, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed 3 times in TBS before being probed with protein A-peroxidase (Merck, 1:50000 in 10% Skimmed Milk in TBS). The membrane was incubated with 1x LumiGLO® / 1x Peroxidase (CellSignal ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with DPBS for 5 minutes and incubated for 1 hour with respective secondary antibodies (Suppl. table 3) and DAPI (#10236276001; Merck Life Science, Dorset, UK) for nuclear counterstaining in 1% donkey serum ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... peptides (<3 kDa) were separated from high molecular size proteins by a 3 kDa cutoff ultrafiltration column (Amicon®, Merck Millipore Ltd., Cork, Ireland). The crude peptides (<3 kDa ...
-
bioRxiv - Biochemistry 2021Quote: ... Centrifugal filters (0.5 mL, 3 k) were purchased from Merck KGaA (Darmstadt ...
-
bioRxiv - Plant Biology 2021Quote: ... brassicicola was maintained on malt medium (3% malt extract (Merck), 1.5% agar-agar (Roth) ...
-
bioRxiv - Plant Biology 2021Quote: ... and half-strength phosphatase inhibitor cocktail 2 and 3 (Merck). Samples were clarified twice by centrifugation at 14 000 g ...