Labshake search
Citations for Merck :
301 - 350 of 4823 citations for 7 Chloro 3 4 2 hydroxyethyl 1 piperazinyl 1 2 propoxyethyl pyrido 3 4 b pyrazin 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... with 2 x concentrated DMEM (Merck), supplemented with 88 mM NaHCO3 ...
-
bioRxiv - Biochemistry 2019Quote: ... MLi-2 was obtained from Merck [30] ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM L-glutamine (Merck, G7513), 100 units/mL penicillin and 0.1 mg/mL streptomycin (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2 μM IWP2 (681671, Merck) and cultured at 37 °C and 5% CO2 for indicated times ...
-
bioRxiv - Microbiology 2019Quote: ... 2% NP40 (Merck Millipore, MA, USA), 1× protease inhibitor cocktail ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Rosetta 2 (DE3) (Merck Millipore) after double-transformation of pET-Duet-1 (α- and γ-subunits ...
-
bioRxiv - Cell Biology 2021Quote: ... fixed with 2 % paraformaldehyde (Merck #158127) for 10 min on ice ...
-
bioRxiv - Immunology 2020Quote: ... PD98059 (50µM, ERK1/2 inhibitor, Merck), JNK-IN-8 (1µM ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2% N-lauryl sarcosine (Merck) for 18 h at 50°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 µl/ml r-lysozyme (Merck), 20 mM NAD (SigmaAldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mM copper sulfate (Merck) for 30 min at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli Rosetta 2 (DE3) cells (Merck), and cultured in Terrific Broth medium at 37 °C and induced with IPTG at a final concentration of 500 μM ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM EGTA (Merck 324626-25GM) and 320 mM sucrose ...
-
bioRxiv - Neuroscience 2023Quote: ... MAP2 (HM-2; Merck, Darmstadt, Germany), IDH 1 (R132H ...
-
bioRxiv - Developmental Biology 2023Quote: ... For the 2-DG (D8375, Merck) treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Benzonase (Merck Millipore, 70664) was added into each 500 µl lysis buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM L-glutamine (Merck/Biochrom), 100 IU/mL penicillin ...
-
bioRxiv - Immunology 2023Quote: ... and antimycin A (2 μM; Merck) were injected to disrupt various elements of the metabolic pathways ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mM MgCl2 (Merck Life science), 5 mM Potassium Ferricyanide (Merck Life science) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 2-mercaptoethanol (M3148 Merck), and 1000 U/mL LIF (ESG1107 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% chloral hydrate (Merck, Cat. C8383) along with 0.3% xylazine (MedChemExpress ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µM of 2-mercaptoenthanol (Merck), 2.5 μg/ml Insulin (Merck) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 µl/ml R-lysozyme (Merck), 10 mM NADPH (Carbolution) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gels were subsequently demulsified with 45 µl 1H,1H,2H,2H Perfluoro 1 octanol (PFO) (Merck, #370533) into 200μl of MM+ Ri medium ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% Amphotericin B (Merck, A2942) and 5 µg/ml Apo-Transferrine (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2020Quote: ... through six consecutive dilution and concentration steps at 4 °C using Amicon Ultra centrifugal filters with a 3 kDa or 10 kDa molecular weight cutoff (Merck). Protein complexes were assembled by mixing the subcomponents at the desired molar ratios ...
-
bioRxiv - Immunology 2022Quote: ... the animal hemi-heads were fixed for 3 days at room temperature in 4% paraformaldehyde (PFA) and decalcified in Osteosoft (Osteosoft; 101728; Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... membrane using wet transfer for 3 h at 90 V/4 °C in transfer buffer (25 mM Tris; 192 mM glycine, Merck; 20% methanol, Merck). Afterwards ...
-
bioRxiv - Neuroscience 2024Quote: ... before being cut into 250μm parasagittal slices using a McIlwain tissue chopper and placed on Millicell membrane (3 to 4 slices each per animal, 0.4 μm membranes, Merck Millipore) in 50% BME (41010026 ...
-
bioRxiv - Physiology 2023Quote: ... Blots were washed 3 x for 7 min with TBS-T (200 mM Tris (Merck), 1.36 mM NaCl (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... and then treated with one mL of bleaching solution [Water + 4% NaOCl (Merck) +1N NaOH (HiMedia ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Neuroscience 2021Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Neuroscience 2020Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Neuroscience 2023Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Neuroscience 2023Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Neuroscience 2024Quote: ... Semithin sections (1–2 μm thick) were obtained from the surface of the block and stained with 1% toluidine blue (Merck, 115930, Germany) in 1% sodium borate (Panreac ...
-
bioRxiv - Biophysics 2021Quote: ... for 1 min in O2 plasma and incubating them with fibronectin (2 μg/mL) (Merck, Darmstadt, Germany) in 100 mM NaHCO3 (pH 8.5 ...
-
bioRxiv - Cell Biology 2021Quote: ... vigorously vortexed for 1 min and leukocytes retrieved by centrifugation were fixed using 2 % paraformaldehyde (Merck #158127) on ice for 10 min and washed with PBS-0.1 % sodium azide solution.
-
bioRxiv - Cancer Biology 2022Quote: ... Phophorylated MEK was detected using anti-phospho MEK 1/2 (residues 218/222 and 222/226, MERCK, catalogue No ...
-
bioRxiv - Biophysics 2019Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
bioRxiv - Immunology 2023Quote: ... were premixed at a 1:9 molar ratio or a 2:98 molar ratio in chloroform (Merck) to arrive at PLBs harboring Ni-DOGS-NTA at 10% or 2% ...
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 0.43 mM MgCl2) with the addition of 0.2 mM 1-phenyl-2-thiourea (PTU, Merck, Germany) to block pigmentation ...
-
bioRxiv - Cell Biology 2023Quote: ... and fertilized eggs were cultured in EmbryoMax KSOM Medium (1X) w/ 1/2 Amino Acids (Merck Millipore) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lipids were dissolved in chloroform:methanol (2:1, v:v) and separated by TLC on silica gel 60 (Merck) along with a standard ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK-293T/phoenix-AMPHO cells were selected for stable expression of retroviral vectors using Hygromycin B (200 µg/mL) and Diphtheria toxin (2 µg/mL; Merck) [16] ...