Labshake search
Citations for Merck :
301 - 350 of 1092 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Schorr staining solution was obtained from Merck (Darmstadt, Germany). Mfel HF (R35895 ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2% Antibiotic Antimycotic Solution (AAS, A5955; Merck, Germany), 2% L-glutamine (L-Glutamine ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was gel purified (Illustra™ GFX PCR DNA and Gel Band Purification Kit, Merck) and used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: Fibrinogen stock solutions were prepared by dissolving 1 g of human fibrinogen lyophilized from 20 mM citrate pH 7.4 solutions (Merck 341576, >90% clottable proteins) into distilled water as recommended by the manufacturer (final volume of app ...
-
bioRxiv - Biophysics 2021Quote: ... Prior every experiment the chamber was washed with analytical grade Milli-Q water (Millipore Advantage system with Millipak Filter, Merck KGaA, Darmstadt, Germany) and the electrodes were used for no more than 10 electric field applications to minimize the oxidation effects on the electrode tips.
-
bioRxiv - Molecular Biology 2024Quote: ... Flash column chromatography was carried out using silica gel (Silicycle SiliaFlash P60, R12030B, 230−400 mesh or Merck Grade 9385, 230−400 mesh). Structures of synthesized compounds were verified by using NMR and spectra of 1H and 13C can be found in Fig ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Microbiology 2024Quote: ... PCR primers were purchased from Merck (Germany) and are listed in supplementary Table S2 ...
-
bioRxiv - Cancer Biology 2024Quote: OncoTICE® vials were resuspended in sterile sodium chloride 0.9% solution at the Day Hospital (Champalimaud Foundation) according to the manufacturer instructions (Merck: 1 vial/50mL saline solution). Remnants from resuspended vials were stored at 4°C and protected from light.
-
bioRxiv - Plant Biology 2020Quote: ... a 200 μM solution of ciliobrevin D (Merck, Darmstadt, Germany) was prepared in a 9:1 water-dimethylsulfoxid (DMSO ...
-
bioRxiv - Immunology 2021Quote: ... nuclei were stained with Mayer’s hematoxylin solution (Sigma Aldrich/Merck) for 15 min at RT ...
-
bioRxiv - Cancer Biology 2020Quote: For immunohistochemistry tissues were fixed in 4% Formaldehyde solution (Merck) and subsequently embedded in paraffin ...
-
bioRxiv - Neuroscience 2020Quote: ... the solution is filtered through 0.22 μm filters (MERCK, SLGP033RS) and transferred to five low-protein binding 1.5 mL tubes ...
-
bioRxiv - Neuroscience 2020Quote: ... The solution is filtered through 0.2 μm filters (MERCK, SLGP033RS), and the filtrate is transferred to black screw cap tubes ...
-
bioRxiv - Neuroscience 2021Quote: ... except that a solution of 0.05 % Tween 20 (P2287 Merck) in PBS was used instead of 0.3 % Triton -PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... 1:10 Mayer’s hemalum solution (Merck KGaA, Darmstadt, Germany, 2min), bluing with running tap water (7min) ...
-
bioRxiv - Cell Biology 2021Quote: ... May-Grünwald and Giemsa solutions (Sigma-Aldrich/Merck, Munich, Germany) stained the cytocentrifuged cells.
-
bioRxiv - Cell Biology 2021Quote: ... and subsequent chromogenic revelation (NBT/BCIP Stock solution, Merck 11681451001). The reaction was stopped in distilled water and slides were mounted with Fluoromount™ aqueous mounting medium (Merck F4680).
-
bioRxiv - Systems Biology 2020Quote: ... The membrane was stained with Amido Black solution (Merck, A8181) for 10 minutes and imaged in a ChemiDoc MP Imaging System (Biorad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... All slides were incubated in eosin solution (Cat. #109844; Merck) for 30 s and then washed with distilled water.
-
bioRxiv - Neuroscience 2021Quote: ... The solution was filtered through 0.2 μm filters (MERCK, SLGP033RS), and the filtrate is transferred to black screw cap tubes ...
-
bioRxiv - Neuroscience 2021Quote: ... The solutions were filtered through 0.2 μm filters (MERCK, SLGP033RS), and the filtrates were transferred to a 15 mL falcon tube ...
-
bioRxiv - Plant Biology 2022Quote: ... An ICP Multi-Element Standard Solution VIII (Merck, Darmstadt, Germany), consisting of 29 elements in dilute nitric acid ...
-
bioRxiv - Immunology 2021Quote: ... TMB solution (Cat no.- CL07-1000MLCN) was purchased from Merck. Bradford reagent (Cat no ...
-
bioRxiv - Biophysics 2021Quote: ... Nuclei were counterstained with Mayer’s hemalum solution (Merck, Darmstadt, Germany). Stained MΦs have a brown-red color ...
-
bioRxiv - Physiology 2022Quote: ... stained with May-grunwald’s eosin-methylene blue solution modified (Merck) for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... 100 µl of trypsin-EDTA solution (Merck KGaA; cat. #T3924) was added and the samples were trypsinized on a bench top shaking incubator (Corning LSE ...
-
bioRxiv - Pathology 2024Quote: ... for 1 hour and counterstained with Mayer’s heamlum solution (Merck) for 30sec ...
-
bioRxiv - Microbiology 2024Quote: ... and a crystal violet solution (0.1% crystal violet (Merck, Germany), 0.04% ethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by secondary staining with a lead staining solution (Merck) at RT for 3 min ...
-
bioRxiv - Biochemistry 2023Quote: Enzyme solutions α-amylase (0.15 g·mL−1; Merck, Darmstast, Germany), pepsin (0.1 g·mL−1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The detection solution was HRP Immobilon Western Substrate (Merck Millipore). The analysis was performed using ANTI-FLAG® M2-Peroxidase (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... A counterstain was carried out with Mayer’s Hemalaun solution (Merck). Osteoclasts were identified as TRAP-positive cells with ≥3 nuclei and adherent to the bone surface ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were stained with Gram’s crystal violet solution (Merck) plus 5% formaldehyde (40% m/v ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by blocking with 2% BSA solution (Merck Life science) in PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... the ‘infiltration solution’ was spiked with 1 mM pyranine (Merck). The pyranine absorption of each AWF was measured to normalize for potential dilution or concentration effects (see 2.5).
-
bioRxiv - Neuroscience 2023Quote: Solutions were filtered using a 0.2μm filter (Millipore, Merck, Germany) before backfilling pipettes ...
-
bioRxiv - Cell Biology 2023Quote: ... Eluted solution was concentrated using an Amicon Ultra 15 (Merck) and then separated on an NGC chromatography system (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1% Antibiotic/Antimycotic solution (Merck Life Science, Gillingham, UK). The cells were maintained in a passively humidified incubator at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... but a 6 mg/mL solution of bovine fibrinogen (Merck) was used instead of plasma ...
-
bioRxiv - Immunology 2024Quote: ... membranes were incubated in AmershamTM ECLTM solution (Merck, Darmstadt, Germany) and images were captured on a Fusion FX - Western Blot & Chemi imaging instrument (VILBER ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 μL of 11mg/mL DL-Dithiothreitol (DTT) solution (Merck) was then added and incubated at 60 °C for 10 min ...
-
bioRxiv - Plant Biology 2024Quote: ... A stock solution of esculin (Merck CAS 531-75-9) was prepared by dissolving 20 mg in 1 ml of 70% ethanol and heating for 5 minutes at 95 °C ...
-
bioRxiv - Microbiology 2024Quote: ... 200□μl of a 0.4% solution of crystal violet (Merck) were added to each well and incubated for an additional 15□min ...
-
bioRxiv - Pathology 2024Quote: ... tissue sections were placed in 1% acetic acid solution (Merck) for 2 - 5 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with Pen/Strep solution (100U/ml; Merck, UK; A5955). All cells were incubated at 37°C with 5% CO2 ...
-
bioRxiv - Cancer Biology 2024Quote: Mouse embryonic fibroblasts were harvested with trypsin-EDTA solution (Merck), washed with complete growth medium and pelleted ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Genomics 2024Quote: ... The samples were digested in a closed-vessel microwave system (MarsExpress; CEM Corp; Matthews, NC, USA) in 2 ml of 30% (v/v) premium-grade H2O2 (Merck, EMSURE®, Darmstadt, Germany) and 5 ml of 65% (v/v ...