Labshake search
Citations for Merck :
301 - 350 of 1718 citations for 5 FLUORO 2 MERCAPTOBENZOTHIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Microbiology 2020Quote: ... TarP or TarM (6.3 μg/ml) for 2 hours at room temperature with UDP-GlcNAc (2 mM, Merck) in glycosylation buffer (15 mM HEPES ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Sox9 (Merck, AB5535; 2 μg/ml); anti-Tfap2a (DSHB ...
-
bioRxiv - Developmental Biology 2021Quote: ... containing 2 mM calcium chloride (Merck, C27902) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... staining with 2% uranyl acetate (Merck KGaA) overnight in water ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-tyrosinated tubulin (YL1/2, Merck), mouse anti-acetylated tubulin (T6793 ...
-
bioRxiv - Immunology 2021Quote: ... and 2 µg/mL TPCK trypsin (Merck). The pfu were counted following staining with 1 % (w/v ...
-
bioRxiv - Immunology 2021Quote: ... with 10 uL/mL 2-ME (Merck) after which RNA was isolated using RNeasy Microprep ...
-
bioRxiv - Neuroscience 2020Quote: 2-phospho-Ascorbic Acid (Merck Sigma, #49752)
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 µL 250 U/µL Benzonase (Merck) and 20 mM lysozyme were added into a 40 mL cell solution and kept on ice for one hour ...
-
bioRxiv - Genomics 2022Quote: ... and 2 kU/mL DNase I (Merck)] at 37 °C for 60 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 kU/mL DNase I (Merck)] at 37 °C for 60 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked using 2% milk (Merck) with 0.05% of normal goat serum (NGS ...
-
bioRxiv - Microbiology 2022Quote: ... 294 mg/L CaCl2(H2O)2 (Merck), 294 mg/L MgCl2(H2O)6 (Merck) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed with PBS-2(Merck), trypsinized and passed through a 40 µm nylon filter (20 ml) ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 2% sucrose (Merck KGaA; type number: 107687), and three drops of fresh yeast ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/mL PK-LD (Merck #P0294), 2 mM GlcNAc and 1 mM ATP ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2 mM PMSF (Merck Life Sciences) and thawed for 30 minutes on ice ...
-
bioRxiv - Microbiology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 (P5726, Merck), 1x cOmplete protease inhibitor (REF) ...
-
bioRxiv - Developmental Biology 2022Quote: ... containing 2 mM calcium chloride (Merck, C27902) overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... coli Rosetta 2 (DE3) BL21 cells (Merck). Transformed bacteria were inoculated in 2× Yeast Extract Tryptone (2YT ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 mM L-glutamine (Merck, #G7513) in a humidified incubator with 5% CO2 at 37 °C ...
-
bioRxiv - Genetics 2023Quote: ... and 2% Protease Inhibitor Cocktail from Merck) were lysed with 0.5 mm Zirconia/Silica Beads in a FastPrep-24TM homogenizer ...
-
bioRxiv - Cancer Biology 2023Quote: Two different siRNAs (Merck, Supplementary Table 2) that target constitutive exons with minimum predicted off-targets were designed and pooled together ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 µL Benzonase (Sigma/Merck # E1014)] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% (w/v) peptone (Merck, Millipore®), 2% (w/v ...
-
bioRxiv - Immunology 2023Quote: ... containing 10 µg/mL 2-mercaptoethanol (Merck). For increasing bacterial dose analysis ...
-
bioRxiv - Genetics 2023Quote: ... 0.1 mM 2-mercaptoethanol (#M6250; Merck KGaA), and ESGRO-2i Supplement Kit (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... and MLi-2 from Merck (Tocris #5756) were used for these experiments as TLR2 inflammatory stimuli and LRRK2 kinase inhibitor respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-deoxyglucose (2DG; catalogue # D8375-5G, Merck Life Sciences UK ...
-
bioRxiv - Plant Biology 2024Quote: ... E.coli Rosetta 2 (DE3) (Merck, Darmstadt, Germany) cells harboring the plasmid p2CT-His-MBP-Lbu_C2c2_WT (Addgene No ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2 µM Thiazovivin (Merck Millipore) on the first day after passaging with daily medium change for at least ten passages before being used for molecular karyotyping ...
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by embedding in 5 % low melting agarose (Merck). Gelatinated blocks were washed in 0.1 M Soerensen’s phosphate buffer (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% (v/v) Donkey serum (Merck Millipore, S30-100ML) for more than 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.