Labshake search
Citations for Merck :
301 - 350 of 5278 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Hydrochloric acid solution was purchased from Merck Millipore (Darmstadt ...
-
bioRxiv - Cell Biology 2024Quote: ... CK666 and bongkrekic acid were from Merck Life Technology S.R.L. ...
-
bioRxiv - Pathology 2023Quote: ... decalcified in 10% ethylenediaminetetraacetic acid (Merck, GER) solution for 60 days ...
-
bioRxiv - Neuroscience 2023Quote: ... and 50 ug/ml Ascorbic Acid (Merck) for 6-9 days refreshing half of the medium every other day starting from day 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by acidification with Trifluoroacetic acid (Merck) to 1% (pH < 2) ...
-
bioRxiv - Plant Biology 2022Quote: ... Formic acid was Suprapure 98-100% (Merck) and trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2023Quote: ... 7.4 mM Citric Acid (Merck Life science), 150 mM NaCl (Merck Life science) ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 μM retinoic acid (Merck Darmstadt, Germany), and 0.25× B-27 (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 25 µM linoleic acid (Merck cat# L9530), 2.8 µM linolenic acid (Thermo Scientific cat# 215040050) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% formic acid (FA, Merck, 1.11670.1000), followed by freeze-drying ...
-
bioRxiv - Microbiology 2024Quote: ... Bile acid standards were supplied by Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2024Quote: ... Citric Acid 0.2 mM (Merck, cat: 251275) in microwave for 5 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... formic acid and acetonitrile were from Merck. MG132 (Cat# HY-13259 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... 1 nM 3,3′,5-Triiodo-L-thyronine sodium salt (Merck, cat. #T6397), and 1% penicillin-streptomycin (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... A solution of 5 g·L-1 bovine serum albumin (Merck-Sigma A9647) was used to construct a standard curve ...
-
bioRxiv - Cell Biology 2022Quote: ... the nuclei were visualized with Hoechst 33258 (Merck, B2883, 2 µg/ml in H2O at RT for 5 min).
-
bioRxiv - Microbiology 2022Quote: ... 5°6.7’ E) in September and October 2017 by filtering 2 L of seawater through PVDF membrane filters (Merck Millipore ...
-
bioRxiv - Biochemistry 2023Quote: ... The proteins were reduced utilizing a 5 mM solution of tris-2-carboxyethyl-phosphine (TCEP) (Merck KGaA, Darmstadt, Germany) at a temperature of 60 °C for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... whose composition is as plating media but with 5% FBS and 2 μM cytosine β-d-arabinofuranoside (Merck, C6645) to limit glial growth ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (all Merck). The oxygen consumption rate (OCR ...
-
bioRxiv - Neuroscience 2021Quote: ... 2′,7′-Dichlorofluorescin diacetate (DCFH-DA, Merck, Darmstadt, Germany, 1 mM) dissolved in PBS was added to each well and the plate was placed in the dark for 10 min at room temperature for cell uptake ...
-
bioRxiv - Neuroscience 2020Quote: ... chicken anti-microtubule-associated protein 2 (MAP2; 1:2000; Chemicon/Merck), and guinea pig anti-vesicular glutamate transporter 1 (VGLUT1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Merck), mounted (Aqua Poly/Mount ...
-
bioRxiv - Neuroscience 2024Quote: ... combined with rabbit anti- MAP-2 (Merck Millipore, #AB5622, 1:800), followed by goat anti-mouse Dylight405 (Jackson ImmunoResearch ...
-
bioRxiv - Immunology 2022Quote: ... rh-HI was prepared in either 20% acetic acid (v/v from acetic acid glacial, Merck KGaA, Darmstadt, Germany), 0.3 M NaCl (Merck KGaA ...
-
bioRxiv - Biochemistry 2023Quote: ... was cultivated anaerobically in proline-containing CDMM (0.76 g/L consisting of 0.1 g/L added to the 0.66 g/L of the casamino acids as characterized for this casamino acids lot, Merck) and harvested by centrifugation in the late exponential phase ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were cultured in LHC9/RPMI 1640 (1:1) without serum as previously described51,52 supplemented with rho-associated protein kinase 1 inhibitor (Y-27632, Merck, 5 mM), SMAD-signaling inhibitors ...
-
bioRxiv - Microbiology 2024Quote: ... Micrococcin P1 was produced as described previously and solubilized to a concentration of 10 mg/ml in dimethyl sulfoxide (Sigma-Aldrich).30 Nisin A was obtained as part of a commercial fermentate which was solubilized to a concentration of 1 mg/ml in a 0.05% acetic acid solution (Merck). AuresinePlus was solubilized to a stock concentration 1 mg/ml in a buffer containing 20 mM Tris-HCl pH 7.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmax supplemented with 1% v/v of the 10% fatty acid-free BSA solution in PBS (Merck cat# A1595) supplemented with 10% Ethanol (Fisher Scientific cat# 10680993 ...
-
bioRxiv - Neuroscience 2024Quote: ... DMSO (0.1%; D4540), L-glutamic acid (L-glutamate, 1 mM; G1251) and Sodium Propionate (5mM; P1880) were obtained from Merck Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... The extracted 212Pb in 0.1 M HCl obtained from the emanation generator was adjusted to pH 5-6 with 5 M sodium acetate (Merck, Darmstadt, Germany) and mixed with TCMC-mAbs with specific activities of 1-50 MBq/mg ...
-
bioRxiv - Biochemistry 2021Quote: ... were mixed with 120 μL of the TBA-TCA reagent (0.038% thiobarbituric acid (Kemika, Croatia) in 15% trichloroacetic acid (Merck, USA). The samples were diluted with 70 μL of ddH2O ...
-
bioRxiv - Biochemistry 2023Quote: ... 40 μg of protein was added to each well and run in Boric acid-Tris buffer (192 mM Boric acid, Merck; 1 mM EDTA ...
-
bioRxiv - Neuroscience 2020Quote: Cell-cycle kinetic differences were assessed by labelling cortical progenitor cells using a nucleotide analog 5-ethynyl-2’-deoxyuridine (EdU; Merck) in vivo following 150 □g EdU injection into the peritoneal cavity of pregnant mice 1 hour before the sacrifice of the embryos ...
-
Revisiting a GWAS peak in Arabidopsis thaliana reveals possible confounding by genetic heterogeneitybioRxiv - Genetics 2021Quote: ... 2 µl of each sample was injected into a SeQuant ZIC-pHILIC HPLC column (Merck, 100 × 2.1 mm; 5 µm), and the respective guard column operated with an Ultimate 3000 HPLC system (Dionex ...
-
bioRxiv - Bioengineering 2022Quote: ... samples were blocked and permeabilized with 2% BSA and 0.1% Triton X-100 (#9036-19-5, Sigma-Aldrich now Merck) in PBS for 30 minutes at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed three times with PBS and boiled for 5 min at 99°C in hot reducing SDS-buffer containing 2-mercaptoethanol (Merck).
-
bioRxiv - Genetics 2023Quote: ... neo-synthesized DNA was labeled by two successive pulses (30 min each) with IdU 20 μM (5-iodo-2’-deoxyuridine, 57830, MERCK) and CldU 100 μM (5-chloro-2’-deoxyuridine ...
-
bioRxiv - Molecular Biology 2024Quote: ... Animals that were collected on day 2 of adulthood were transferred to plates containing 5-FU (10 µM) (Merck, #F6627) at the L4 larval stage to prevent progeny production ...
-
bioRxiv - Cell Biology 2024Quote: ... Pups were then put on the ice for 5 minutes and exsanguinated by terminal intracardial perfusion with ice-cold 2% paraformaldehyde (Merck) in phosphate-buffered saline (PBS) ...
-
bioRxiv - Microbiology 2024Quote: ... some plates were prepared with the addition of the redox indicator 2,3-diphenyl-5-(2-thienyl) tetrazolium chloride (STC; Merck, USA) at a final concentration of 50 µg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... Pups were then put on the ice for 5 minutes and exsanguinated by terminal intracardial perfusion with ice-cold 2% paraformaldehyde (Merck) in phosphate-buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... blocked for 2 h in blocking solution (5% normal goat serum from Vector Laboratories, 0.5% Triton X-100 from Merck in PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Methanol extracts were diluted 1:5 in Milli-Q water (Merck, Darmstadt, Germany) and subjected to reversed phase HPLC-MS using an Accela 1250 HPLC system equipped with a Hypersil Gold aQ column and coupled to a QExactiveTM mass spectrometer (all from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM β-mercaptoethanol and 1% (v/v) complete protease inhibitor cocktail (Merck). The protein concentration was quantified in crude extracts with the Bradford assay (Bradford ...
-
bioRxiv - Physiology 2024Quote: ... Mice also received Prednisolon (1 mg/kg diluted in 5 % glucose i.p., Merck) up to 10 days post-surgery to reduce the potential immune response to the LV-vectors.