Labshake search
Citations for Merck :
301 - 350 of 5768 citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... To deplete Xrn1 and Dcp2 with the AID tags (Nishimura et al., 2009; Morawska and Ulrich, 2013) 1-Naphthaleneacetic acid (1-NAA; N0640-25G, Merck) was added to a final concentration of 1 mM ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Birds from the anxiogenic group received 2.5 mg/kg of β-CCM (β-carboline-3-carboxylic acid-N-methylamide [FG 7142], Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) dissolved in DSMO (Dimethyl Sulfoxide suitable for HPLC ...
-
bioRxiv - Physiology 2022Quote: ... Phosphomolybdic Acid Orange G (Merck AG ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.01% pluronic acid (Merck) for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 14% acetic acid (Merck). Plates were washed in water ...
-
bioRxiv - Microbiology 2020Quote: ... propionic acid (Merck, Darmstadt, Germany), n-valeric acid (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Pure oxalic acid (Merck, Germany) was identified by the retention time and was quantified by an external standard curve ...
-
bioRxiv - Microbiology 2022Quote: ... L-lactic acid (~90%, Merck), ethanol and glycerol were added to final concentrations of 40 mM ...
-
bioRxiv - Physiology 2022Quote: ... water and formic acid (Merck) in different proportions ...
-
bioRxiv - Cell Biology 2023Quote: ... and L-ascorbic acid (Merck) supplemented with FGF2 (4 ug/mL ...
-
bioRxiv - Immunology 2023Quote: ... and concentrated sulfuric acid (Merck) for at least 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... Linolenic acid (L2376-500MG, Merck), L-Carnitine hydrochloride (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 150 µM ascorbic acid (Merck), 55 µM β-mercaptoethanol (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... folic acid (FA, Merck, #F8758) and 5-methyltetrahydrofolate (5-MTHF ...
-
bioRxiv - Physiology 2024Quote: ... in picric acid (80456, Merck) for 2 hours.
-
bioRxiv - Biochemistry 2024Quote: ... sulfuric acid (H2SO4, Merck, 97%), potassium dichromate (K2Cr2O7 ...
-
bioRxiv - Synthetic Biology 2024Quote: Stearic acid (C18:0, Merck)
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5 mM ascorbic acid (Merck), 0.84 uM biotin (Merck) ...
-
bioRxiv - Biochemistry 2024Quote: ... fatty acid-free (Merck, 10775835001) was substituted for regular (ThermoFisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 20μM Retinoic Acid (Merck). At day 6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with media containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 μl of cell suspension was collected and mixed with 200 μl of ice-cold HBSS containing 5% fatty acid-free bovine serum albumin (BSA, Merck Millipore, 126575-10GM). To quench the fluorescence of non-internalized NBD-phospholipids ...
-
bioRxiv - Genetics 2022Quote: ... 5 µg SA8 was dissolved in 10 µL 10 mM hydrochloric acid and digested with 20 ng/µL pepsin (Merck, cat. No. 10108057001) at 37 °C for 6 h ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Immunology 2023Quote: ... Bacterial cells processed via ultrasound and insoluble inclusion bodies were extracted with 1% deoxycholic acid (Merck) and 1% Triton X-100 (Merck ...
-
bioRxiv - Physiology 2024Quote: ... followed by 1% acetic acid for 30 seconds and Safranin’O solution for 45 min (S2255, Merck).
-
bioRxiv - Pathology 2023Quote: ... 1 µl of CAA (400mM 2-Chloroacetamide (#C0267, Merck) was added ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Neuroscience 2020Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 × 106 CGNs were mixed with 2 μg of a Mission shRNA vector for Snph (TRCN0000201959, Merck, Darmstadt, Germany) or pLKO.1-TRC-control (Addgene_#10879 ...
-
bioRxiv - Biochemistry 2024Quote: Mixing of lysozyme crystals (7×2 mm; grown by batch crystallisation) with 25 mM sulfanilic acid azochromotrop (SAA, Merck, lmax 505–510 nm), a highly absorbing red dye ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were passaged twice a week using 2 mM ethylenediaminetetraacetic acid in phosphate buffer saline (EDTA/PBS; Thermo Fisher Scientific, Waltham, USA; Merck, Darmstadt, Germany) adding 10 µM Y27632 (Miltenyi Biotec ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...