Labshake search
Citations for Merck :
301 - 350 of 1997 citations for 2 Triisopropylsilyl Oxazole 5 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM L-glutamine (Merck, G7513), 100 units/mL penicillin and 0.1 mg/mL streptomycin (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 2 μM IWP2 (681671, Merck) and cultured at 37 °C and 5% CO2 for indicated times ...
-
bioRxiv - Biochemistry 2021Quote: ... coli Rosetta 2 (DE3) (Merck Millipore) after double-transformation of pET-Duet-1 (α- and γ-subunits ...
-
bioRxiv - Cell Biology 2021Quote: ... fixed with 2 % paraformaldehyde (Merck #158127) for 10 min on ice ...
-
bioRxiv - Immunology 2020Quote: ... PD98059 (50µM, ERK1/2 inhibitor, Merck), JNK-IN-8 (1µM ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2% N-lauryl sarcosine (Merck) for 18 h at 50°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli Rosetta 2 (DE3) cells (Merck), and cultured in Terrific Broth medium at 37 °C and induced with IPTG at a final concentration of 500 μM ...
-
bioRxiv - Biophysics 2023Quote: ... 2 mM EGTA (Merck 324626-25GM) and 320 mM sucrose ...
-
bioRxiv - Neuroscience 2023Quote: ... MAP2 (HM-2; Merck, Darmstadt, Germany), IDH 1 (R132H ...
-
bioRxiv - Developmental Biology 2023Quote: ... For the 2-DG (D8375, Merck) treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Benzonase (Merck Millipore, 70664) was added into each 500 µl lysis buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM L-glutamine (Merck/Biochrom), 100 IU/mL penicillin ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mM copper sulfate (Merck) for 30 min at room temperature ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 2 µl/ml R-lysozyme (Merck), 10 mM NADPH (Carbolution) ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1 mM 2-mercaptoethanol (M3148 Merck), and 1000 U/mL LIF (ESG1107 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2% chloral hydrate (Merck, Cat. C8383) along with 0.3% xylazine (MedChemExpress ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µM of 2-mercaptoenthanol (Merck), 2.5 μg/ml Insulin (Merck) ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 µl/ml r-lysozyme (Merck), 20 mM NAD (SigmaAldrich) ...
-
bioRxiv - Immunology 2023Quote: ... and antimycin A (2 μM; Merck) were injected to disrupt various elements of the metabolic pathways ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 mM MgCl2 (Merck Life science), 5 mM Potassium Ferricyanide (Merck Life science) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 2 mM L-glutamine (Merck Millipore) and 1% penicillin/streptomycin (Merck Millipore ...
-
bioRxiv - Bioengineering 2024Quote: ... 2 µM retinoic acid (R2625, Merck) was added ...
-
bioRxiv - Immunology 2024Quote: ... 100mM 2-Deoxy- D-Glucose (Merck), 1μM Oligomycin A (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 min in Eosin (115935, Merck), 1 min in 100% ethanol and embedded with DPX.
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM copper sulfate (Merck, #C7631), and 25 μg/mL chloramphenicol (Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 mM copper sulfate (Merck, #C7631), and 25 μg/mL chloramphenicol (Merck ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM L-glutamine (Merck) (complete fibroblast medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM L-glutamine (Merck).
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 2% Penicillin-Streptomycin (Merck), 2 µg/mL puromycin (Invivogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µg/mL Dox (Merck, D9891) was added into SRM ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... The faecal slurries were aliquoted into tubes and 250 nM of ATTO 488-tagged Mission MicroRNA mimics (Sequence: 5’-[ATTO488]UCAACAUCAGUCUGAUAAGUCUA [dT][dT]-3’) and miR-21scr (Sequence: 5’-[ATTO488]AUCUUAUAACGACCGAAUAUUGC[dT][dT]-3’; both from Merck) were added ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracts were spotted on a 5 cm x 5 cm TLC Silica gel 60 F₂₅₄ plate (Merck, Darmstadt, Germany). The blots were stained by spraying with a methanolic solution including 1% diphenylboric acid 2- aminoethylester (DPBA ...
-
bioRxiv - Genetics 2024Quote: ... 90%, 100% ethanol, 5 min each), cleared in xylene (twice, 5 min each) and mounted with DPX mounting medium (Merck).
-
bioRxiv - Developmental Biology 2024Quote: ... germanica adults using an antisense LNA (locked nucleic acid) probe conjugated to Digoxigenin (DIG) at the 5’ and 3’ ends (5’-DIG-GGAGGTCCCCCAGACCGGCACAGACCGAA-DIG-3’, Merck). Ovaries were dissected under Ringer’s saline ...
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...