Labshake search
Citations for Merck :
301 - 350 of 5643 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 50 μM 2-mercaptoethanol (Merck), 2.5 μg/mL Insulin (Merck) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 mM L-glutamine (Merck), 100 units/L penicillin ...
-
bioRxiv - Biochemistry 2024Quote: ... 2% (w/v) glucose (Merck), 2% (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... Methanol extracts were diluted 1:5 in Milli-Q water (Merck, Darmstadt, Germany) and subjected to reversed phase HPLC-MS using an Accela 1250 HPLC system equipped with a Hypersil Gold aQ column and coupled to a QExactiveTM mass spectrometer (all from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM β-mercaptoethanol and 1% (v/v) complete protease inhibitor cocktail (Merck). The protein concentration was quantified in crude extracts with the Bradford assay (Bradford ...
-
bioRxiv - Physiology 2024Quote: ... Mice also received Prednisolon (1 mg/kg diluted in 5 % glucose i.p., Merck) up to 10 days post-surgery to reduce the potential immune response to the LV-vectors.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... NMDA (1 µM, 10 µM or 20 µM, Merck, CAS 6384-92-5) was washed in through the perfusion system and the change of Ihold ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (#D9542, Merck. Darmstadt. Germany).
-
bioRxiv - Physiology 2022Quote: ... cultures were fixed with 4% PFA and stained with 2% Alizarin red S (Merck). For the quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and 300 nM 4′,6′-diamidino-2-phenylindole (DAPI) (Merck, Germany; #28718-90-3). Fluorescence signals were observed by an ECLIPSE TE2000-U fluorescence microscope (Nikon ...
-
bioRxiv - Developmental Biology 2024Quote: ... grids were post-stained with 2% aqueous uranyl acetate at pH 4 (Merck, Germany) and Reynold’s lead citrate ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µl of each dilution were mixed with 10 µl of 0.4 mg ml-1 4-methyl-umbelliferyl-β-D- galactopyranoside (MUG) substrate (Merck, Darmstadt, Germany) that was prepared in dimethyl sulfoxide (DMSO ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequent thorough rinsing with ultrapure water (18.2 MΩ at 25 °C, maximum 2 ppb total organic carbon, Milli-Q Integral 5 Water Purification System, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Neuroscience 2022Quote: ... were randomly assigned to receive an injection of 0.9% NaCl v/v 5-bromo-2’Deoxyuridine (BrdU) 100 mg/kg (MERCK; New York, USA) three times within the same day ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The protein was concentrated overnight to a volume of 2 mL in a Vivaspin 20 Ultrafiltration Unit (5 kDa MWCO)(Merck, Darmstadt, Germany) and then loaded onto a HiLoadTM 26/60 Superdex TM 75 prep grade (GE Healthcare ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated overnight with a primary antibody mixture of guinea pig anti-glycine transporter 2 (GlyT2; 1:10,000; AB1773, Merck, RRID:AB_90953) and mouse anti-GAD67 (1 µg/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... The cells were transduced with LV particles at low multiplicity of infection (MOI: 1-2) in the presence of 10 µg/mL of polybrene (Merck). HEK293T-EGFP were selected with 1 µg/mL of puromycin ...
-
bioRxiv - Genomics 2021Quote: Cultures of three Lasiodiplodia and five Neofusicoccum species (Table 1) were inoculated onto cellophane covered 2 % malt extract agar (MEA; Biolab, Merck) and incubated at 22 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The blocks were then washed with DDW 2 times for 10 min and incubated in 1% (w/v) uranyl acetate (Merck)/70% (v/v ...
-
bioRxiv - Microbiology 2022Quote: ... the Milliplex SARS-CoV-2 Antigen Panel 1 IgG was used according to the manufacturer’s instructions (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Cancer Biology 2020Quote: ... cells were lysed in 500 μl of lysis buffer (8 mL of cold PBS and 2 mL of 10% Triton X-114 supplemented with Halt Protease inhibitor (1:100) and Bezonase (Merck) (1:1000)) ...
-
bioRxiv - Microbiology 2021Quote: ... Acid digestion was then performed for 3 h at 90°C placing the PP tubes on Teflon heating blocks after adding 2 mL hydrochloric acid and 1 mL nitric acid (10 M HCl and 14 M HNO3, respectively, both Suprapur, Merck) following protocol adapted from (62 ...
-
bioRxiv - Cancer Biology 2021Quote: Primary HPMECs in EBM2 medium or ST1.6R cells in DMEM/1% FBS were cultured overnight and stimulated with 2 μg/ml of recombinant TNC (Merck Millipore) for 24 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Lipids containing [6-3H]GlcN-PI were dissolved in 100 μL of chloroform: methanol (2:1, by volume) and loaded to a high performance thin-layer chromatography (HPTLC) plate (Merck). The [6-3H]GlcN-PI was located by phosphorimaging ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1-oleoyl-2-acetyl-sn-glycerol (OAG) and 4α-phorbol 12,13-didecanoate (4α-PDD) were obtained from Merck (Gillingham, UK). Sphingosine-1-phosphate (S1P ...
-
bioRxiv - Neuroscience 2021Quote: ... MDMi cells were incubated with a primary antibody against Iba1 (1:1,000; 019-19744, FUJIFILM Wako Chemicals) in blocking buffer (2% bovine serum albumin, 0.1% TritonX100 (Merck, Darmstadt, Germany), and 5% normal donkey serum (017-000-121 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was eluted from the filter with 2 x 50 µl of Elution Buffer and 1 x 50 µl with DEPC-treated Molecular Biology Grade water (Merck). RNA samples were quantified with NanoDrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Peak fractions were concentrated to 2 mg mL-1 using 100 kDa molecular weight cut-off centrifugal filters (Merck Millipore). To each 300-mesh holey carbon grid (Au R1.2/1.3 ...
-
bioRxiv - Neuroscience 2023Quote: ... FOs were sonicated 2 x 10 sec in ice-cold 1:2 methanol/chloroform solvent containing SPLASH LIPIDOMIX MS standard internal standard mix (Merck). 1:6 H2O was added to the samples before shaking at 1000 rpm ...
-
bioRxiv - Microbiology 2024Quote: ... from the resin was immediately neutralized with 1/10 faction volume of 1 M Tris-HCl pH 8.5 and concentrated using an Amicon Ultra-2 Centrifugal Filter Unit 100kDa NWMCO (Merck Millipore), in which the elution buffer was exchanged with PBS (GIBCO).
-
bioRxiv - Molecular Biology 2024Quote: ... The embryos were then incubated with anti-cleaved caspase 3 pAb (1:100) (Anti-caspase-3, cleaved (Ab-2) Rabbit pAB (PC679; Merck) followed by a wash and a second incubation with anti-rabbit 568 ...
-
bioRxiv - Neuroscience 2024Quote: ... the brains were removed and post-fixed for 1–2 days before transfer to 30% sucrose (Merck KGaA, Darmstadt, Germany) dissolved in PBS ...
-
bioRxiv - Bioengineering 2024Quote: Fresh macroscopically normal omental and peritoneal tissues were cut into 1-2 mm3 pieces and placed into non-adherent U-bottom 96 well plates (Merck). A solution with 10,000 cells in 10 μl media was added and cells were allowed to attach to the tissues for 2 h at 37°C ...
-
bioRxiv - Biophysics 2022Quote: HEK293T cells were cultured in 10 cm tissue culture treated dishes grown at 37 °C in a 5% CO2 atmosphere in HEPES buffered DMEM/F12 1:1 (Merck) supplemented with 10% fetal bovine serum and 2 mM L-glutamine ...
-
bioRxiv - Immunology 2023Quote: ... peptides were dissolved at a concentration of 1 to 5 mg ml-1 in 1x PBS and incubated with TCEP agarose CL4-B (Merck) for 1 hour to reduce paired cysteines ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were then incubated for 5 min in a 1:1 mixture of propylene oxide (Sigma-Aldrich, Merck, Darmstadt, Germany) and absolute ethanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Selection for single clones was performed using 2 µg/µl puromycin (Merck; 58-58-2) for PaTu8988t cells and 0.3 µg/µl for BxPC3 cells ...
-
bioRxiv - Microbiology 2024Quote: ... Primary CD4+ T-cells were activated with 100U/μl of interleukin-2 (IL-2; Merck) and phytohemagglutinin-L (PHA-L ...
-
bioRxiv - Neuroscience 2024Quote: ... and after 2 days oxidative stress was induced by adding 2 mM H2O2 (#349887, Merck) for1 hour ...
-
bioRxiv - Bioengineering 2023Quote: ... potassium dihydrogen phosphate and sodium hydroxide were purchased from Merck Chemicals ...
-
bioRxiv - Cancer Biology 2024Quote: ... The extracted 212Pb in 0.1 M HCl obtained from the emanation generator was adjusted to pH 5-6 with 5 M sodium acetate (Merck, Darmstadt, Germany) and mixed with TCMC-mAbs with specific activities of 1-50 MBq/mg ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were blocked in 5% skim milk in TBS for 1 hour and probed with mouse γ/9d 2G10.2 (1:1000, MERCK MABT1335), rabbit anti mouse IgG (1:3000 ...
-
bioRxiv - Biophysics 2020Quote: GMPCPP-stabilized microtubules were grown using a mixture of 1.3 mg ml−1 tubulin and 2 mM GMPCPP (Merck, NU-405L) in BRB80 and incubated for 1 hour (stepping and photobleaching assay ...
-
bioRxiv - Neuroscience 2021Quote: ... The brains were removed and post-fixed for 1-2 days and then transferred to 30% sucrose (Merck KGaA, Darmstadt, Germany) dissolved in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... All samples were further concentrated to a final volume of 1-2 ml using 100 kDa Amicon-ultra filters (Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 10 kDa ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were subsequently washed with PBS and incubated for 2 h with the proper secondary antibodies (1:300, goat anti-rabbit Alexa-Fluor® 647, AP187SA6, Merck Millipore ...
-
bioRxiv - Paleontology 2020Quote: All aqueous solutions were prepared from ultrapure grade water obtained by water filtration with a two stages Millipore system (Milli-Q® Academic with a cartouches Q-Gard 1 and Progard 2, Merck Millipore ...