Labshake search
Citations for Merck :
3201 - 3250 of 3431 citations for Rat Interleukin 1 Receptor Antagonist IL1RN ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... All supernatant was removed using a 1 ml syringe and the beads were resuspended in 30 μl 2X SDS Sample Buffer (Merck Millipore). The samples were incubated at 98°C for 5 minutes before electrophoresis.
-
bioRxiv - Biochemistry 2021Quote: ... with 0.1% (w/v) RapiGestTM SF surfactant (Waters, UK) and protease inhibitors (Roche cOmpleteTM, Mini, EDTA-free Protease Inhibitor Cocktail, Merck, UK).
-
bioRxiv - Biochemistry 2020Quote: ... epithelium suspension cell line expressing the EBNA-1 protein (female origin) was cultured in EX-CELL(r) 293 Serum-Free Medium (Merck, 14571C) containing 4 mM GlutaMAX supplement (TermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... fixed with a 4% PFA solution and stained for tyrosine hydroxylase (TH; rabbit anti-TH, 1:1000, Cat#: 657012, Merck Millipore) and neurobiotin (Streptavidin Alexa Fluor conjugate 647 ...
-
bioRxiv - Systems Biology 2021Quote: ... A volume of 1 mL supernatant was transferred to an LC glass vial using Millex-HV PVDF syringe filter tips (Merck Millipore). The HPLC column (Aminex 300-mm HPX-87H ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... The supernatant was removed with a 1 ml syringe and the beads were resuspended in 30 μl 2X SDS Sample Buffer (Merck Millipore). The samples were incubated at 98°C for 5 min and the samples were posteriorly collected by centrifuging for 5 minutes at 16000 xg.
-
bioRxiv - Microbiology 2020Quote: ... and the other stored at −80 °C in a sterile 2 ml cryovial containing 1 ml of a 30 % glycerol solution, prepared by diluting glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Immunology 2021Quote: ... weighed and then dissociated using scissors in 1.2 mL of digestion media containing 1 mg/mL collagenase D (Merck Life Sciences) and 0.1 mg/mL DNase I (Merck Life Sciences ...
-
bioRxiv - Molecular Biology 2021Quote: Xist expression was driven by a TetOn promoter induced by addition of 1 µg/mL of doxycycline (Merck Life Science, D9891). Prior to experiments ...
-
bioRxiv - Immunology 2022Quote: Cells were lysed by addition of a mild lysis buffer containing 1% octyl-β,D-glucopyranoside (#O9882-500MG, Sigma-Aldrich, Merck), 0.25% sodium deoxycholate (#1065040250 ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were placed in fresh buffer PBS-T-milk for 1h (or 1h30 when performing the LTAs western blot in parallel) with the polyclonal rabbit anti-PBP2B antibody (at 1:5000, lab. stock or available at Merck ABS2199), the mouse monoclonal Penta-His antibody (Qiagen n°34660 stock at 200 µg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... and additional wells with 20% biotinylated PLL-g-PEG and FNIII(7-10) were supplemented with 1 µM staurosporine (Merck Millipore) to serve as a positive control for apoptosis ...
-
bioRxiv - Biochemistry 2022Quote: ... The eluate of the affinity purification was concentrated to a volume between 1-2 mL before injection using centrifugal filter units (Amicon, Merck millipore) with a MWCO of 5,000 Da ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Cell Biology 2022Quote: ... pre- equilibrated with PBS) and were concentrated to 1 mg/mL using a 10-kDa cutoff Amicon Ultracell Centrifuge Filter Unit (Merck, UFC5010BK), and stored at 4°C in the dark.
-
bioRxiv - Evolutionary Biology 2022Quote: ... the experiments were performed in 96-wells plates containing 100 μL of MM (with 1% agar) supplemented or not with 3mM of H2O2 (Merck S.A) or 0.15mM of menadione (Sigma-Aldrich) ...
-
bioRxiv - Physiology 2022Quote: ... 20S proteasome activity as well as reactive oxygen species production, 300 µl Tris-Buffered Saline (TBS, pH 7.6) and 1% Triton X-100 (Merck, Darmstadt, Germany) were added to a tissue powder aliquot and homogenization was performed using ten consecutive passages through a 24-gauge needle on ice ...
-
bioRxiv - Physiology 2022Quote: ... To generate protein homogenates suitable for western blot analysis, 300 µl Tris-Buffered Saline (TBS, pH 7.6) + 1% Triton X-100 (Merck, Darmstadt, Germany) supplemented with 1x Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... yeast of cell line BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) was grown in 1 litre of YPD (yeast extract (Merck/Sigma-Aldrich cat. no. 70161), peptone (Merck/Sigma-Aldrich cat ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated overnight at 4°C with primary antibodies against AVP neurophysin II (NP-II; MERCK, MABN845, PS41; 1:200); OXT NP-I (PS38 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were maintained in Opti-MEM™ I Reduced Serum Medium + GlutaMax™ (Thermo Fischer Scientific) supplemented with 2% foetal bovine serum (FBS, Thermo Fischer Scientific) and 1% Anti-Anti 100X (Merck) at 37 °C in a humified atmosphere of 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were incubated with a BG4-Flag antibody (1:100 diluted in 0.5% goat serum + PBST, MABE917, Merck, Darmstadt, Germany) for 1 h at 37 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... and concentrated to 2 mg chlorophyll mL-1 using a 100-kDa molecular-weight cut-off centrifugal filter unit (Amicon Ultra-15, Merck Millipore). A 3 µl volume of the sample was applied to a glow-discharged holey carbon grid (GIG ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The pre-cleared lysates were then incubated overnight at 4°C with polyclonal rabbit anti-TipR antibodies (1:400 dilution) (Kirkpatrick and Viollier, 2014) or monoclonal rabbit anti-HA antibodies (1:250 dilution) (Clone 114-2C-7, Merck Millipore). ...
-
bioRxiv - Neuroscience 2022Quote: ... and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4, Merck KGaA, Germany) in 0.05 M sodium borate buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... slices were incubated for 24-48h at 4°C with mouse anti-Neurophysin I (1:2000, Merck Millipore, marker for Oxytocin), rabbit anti-vasopressin (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: ... in 100µl of binding/wash buffer supplemented with protease inhibitor with protease inhibitor cocktail Set I-Calbiochem 1:100 (Cat# 539131, Merck Millipore) and phosphatase inhibitors ...
-
bioRxiv - Plant Biology 2024Quote: ... ACN and then rehydrated with 30 µL of 3.33 µg × mL-1 trypsin (cat-no. T6567 from Sigma-Aldrich/Merck, www.sigmaaldrich.com) in 25 mM ABC ...
-
bioRxiv - Neuroscience 2024Quote: ... tissue samples were incubated on ice for 30 min in 1 ml of HPLC-gradient grade methanol (Merck KGaA, Darmstadt, Germany) containing the deuterated internal standards 2-arachidonoylglycerol-d5 (100 ng/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2024Quote: ... pH 7.0) containing the cOmpleteTM EDTA-Free protease inhibitor at a 1 x concentration following manufactureŕs instructions (Merck Millipore, Darmstadt, Germany). The buffer volume was proportional to the cell density of the sample ...
-
bioRxiv - Immunology 2024Quote: ... U-937 cells were maintained in RPMI-1640 medium supplemented with 4.5 g/L glucose, 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, 1.0 mM sodium pyruvate (Sigma-Aldrich; Merck KGaA), 10% fetal bovine serum (Hyclone ...
-
bioRxiv - Cell Biology 2023Quote: ... The next day cells were lysed in 200 µl of PEG switch sample buffer (PS buffer) (1% SDS, 50 mM HEPES) supplemented with 100 mM NEM (Merck, E3876), 1 mM PMSF (Merck ...
-
bioRxiv - Genomics 2024Quote: ... 8 x 106 HeLa-Cas9-p65-mNeonGreen cells 10 were transduced with 1 ml lentivirus library and 10 μg/ml polybrene (Merck Millipore). After one day ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
bioRxiv - Biochemistry 2024Quote: ... The purified protein sample was concentrated to 40 mg mL-1 using Amicon Ultra-15 3K MWCO Centrifugal Filter Unit (Merck Millipore) and subsequently diluted 1:4 with MilliQ water (yielding 10 mg mL-1 of protein in 1x crystal buffer (10mM Tris ...
-
bioRxiv - Biophysics 2023Quote: ... and the protein of interest was concentrated to 1-2mg/ml in a 50kDa molecular weight cut-off concentrator (Amicon Ultracel, Merck-Millipore). The resulting protein solution was subjected to size exclusion chromatography on a Superose 6 column (Cytiva ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were split into either 6 well-plates (300000 cells per well) coated with 1 mg/ml Poly-L- Lysine (PLL, Merck, P9155) for western blotting ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cell suspension was centrifuged for 3 min at 200 x g and pellets resuspended in 1% BSA in PBS by pipetting 4 times up and down and filtering through 40 μm Flowmi strainer (Merck, Germany). Apoptotic and duplet cells were removed by staining the cell suspension with propidium iodide (Invitrogen ...
-
bioRxiv - Pathology 2023Quote: ... blocked with normal serum for 1 h at 22–24°C and incubated overnight at 4°C with rabbit polyclonal anti-Lubricin antibody (1:500, MABT401, MERCK, DEU). The sections were then washed three times with PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were incubated overnight on a rocker at 4 °C with appropriate combinations of the following antibodies: guinea pig anti-RBPMS (1:300, catalog no. ABN1376; Merck Millipore); goat anti-Brn3a (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfectants with stably integrated GOI were then selected based on their resistance to G418 (0.5 mg/ml, 1-2 weeks, Merck, Cat.N. G8168). To induce the expression of the GOI the cells were treated with doxycycline (2 μg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... The chromatin pellet was then digested in 100 μl of water supplemented with 1 μl of Benzonase (25–29 units, Merck Millipore) for 15 min at 37°C in a thermomixer at 1,400 rpm ...
-
bioRxiv - Microbiology 2023Quote: ... the solution was incubated at 30 °C for 90 min and then derivatized with 20 µl of N-methyl-N-trimethylsilyltrifluoroacetamide with 1% trimethylchlorosilane (Merck, USA) at 70 °C for 30 min54 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated for 1 hour at room temperature with the anti-NOTCH1 primary antibody (Merck Life Sciences, Cat #: SAB4200024) diluted at 1:350 in 1% BSA blocking solution ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... The purity of the cultures was be routinely assessed by examining the characteristic cell morphologies under phase-contrast microscopy and confirmed by immunostaining with mouse anti-GFAP (1:200; Merck, MAB3402) and mouse anti-S100β (1:400 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The routinely used growth medium was composed of yeast extract (1%(w/v)) (Fisher BioReagents™) and casein peptone (2%(w/v)) (Merck), and was supplemented with 2% (w/v ...