Labshake search
Citations for Merck :
3051 - 3100 of 5241 citations for 6 Methyl 3 4 dihydro 2H pyrido 3 2 b 1 4 oxazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Molecular Biology 2024Quote: ... The nuclei pellet was washed once in 5 mL of Honda buffer then purified on a Percoll density gradient as follows: 2 mL of 75% Percoll (Merck, P7828) in Honda buffer topped with 2 mL of 40% Percoll in Honda buffer topped with the nuclei pellet resuspended in Honda buffer in a 15 mL tube ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Developmental Biology 2023Quote: Cells were homogenized in 20 mM Tris-HCl buffer (pH 7.2, 0.2 mM EGTA, 5 mM β-mercaptoethanol, 2% (v/v) antiprotease cocktail (Merck KGaA, Germany), 1 mM PMSF ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Neuroscience 2020Quote: ... antigen retrieval and antibody staining (anti-PER2, Alpha Diagnostic, cat. PER21-A, 1:200 dilution; anti-GFAP, Abcam, cat. ab53554, 1:500 dilution; anti-NeuN, Merck Millipore, cat. mab377, 1:250 dilution). The procedures have been described by our laboratory in detail elsewhere (Brenna et al. ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... and incubated with the primary antibody (cofilin, Cell Signaling, cat. 5175S, 1:3000; HA-Tag, Santa Cruz, sc-7392, 1:1000; GAPDH, Merck Millipor, No. AB2302, 1:2000) for 12 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM MgCl2) containing 1% BSA and incubated overnight with the G4-specific antibody (BG4, MABE917, Merck) at 500 ng/mL in BG4 buffer containing 1% BSA ...
-
bioRxiv - Genetics 2019Quote: ... rabbit anti-TbRBP16 [1:1,000] (27) and mouse anti-EF1a [1:200,000] (clone CBP-KK1, Merck-Millipore) for 18 h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... in the presence of enzymatic digestion solution containing 1 mg ml-1 collagenase II (Merck Millipore, 234155), 1 mg ml-1collagenase IV (Merck Millipore ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked for 1 hour in PBS supplemented with 1% Tween-20 (Merck MP Biomedicals) and 5% skimmed milk (Friesland Campina) ...
-
bioRxiv - Developmental Biology 2022Quote: ... different concentrations from 1:10 to 1:10000 (V/V) were freshly diluted in absolute ethanol (Merck). For NaCl chemotaxis ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:600-diluted rabbit anti-CENP-C (#554),55 mouse anti-HP1α (1:1,000, #MAB3584, Merck Millipore), rabbit anti-HP1β (1:800 ...
-
bioRxiv - Neuroscience 2024Quote: ... Postfixation was applied using 1% Osmiumtetroxid (Science Services, München, Germany) and 1% Potassium hexacyanoferrat (Merck, Darmstadt, Germany) for 30 min at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... the blots were incubated with primary antibodies α-FLAG (Merck, F1804, 1:1000], α-TPLATE34(1:1000), α-AtEH1/Pan135(1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Ki67 (rabbit, 1:400, CST, Cat. no 9661S) and cCas3 (rabbit, 1:600, Merck, Cat. no AB9260). The cells were fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Microbiology 2023Quote: ... diluted 1 : 100 in 1 × PBS buffer (pH 7.5) with 0.1 % hydrogen peroxide (stock concentration 30 %, Merck) and 2 mM ATP (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... or α-tubulin (1:1000; 12G10) and rabbit polyclonal antibodies against detyrosinated tubulin (1:10000, AB3021, Merck) and 3-NT (1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... We loaded 10 µL of protein mixed in a 1:1 ratio with Laemmli 2x Concentrate (Merck). The gel was ran for 35min at 200V with Tris/Glycine/SDS buffer (BIORAD ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3h at 16°C to remove the 6-His and MBP tag before phase separation in reaction mixtures in buffer C containing 10μM of WT or W1145R TopBP1b6-8-GFP and 2% of PEG4000 (Merck-Sigma-Aldrich, 95904). Reaction mixtures were mixed by gently tapping the Eppendorf ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were allowed to adhere overnight (16 h) in the presence of 2 mM Thymidine (S-phase block; Merck, Darmstadt, Germany) and released into fresh medium ...
-
bioRxiv - Microbiology 2019Quote: ... Under these conditions nitrite was not detectable with a colorimetric test with a lower detection limit of 2 mg/L (MQuant test stripes, Merck, Darmstadt, Germany). Growth conditions and operation of the bioreactor containing ANME-2d archaea enriched from an Italian paddy field soil are described by Vaksmaa et al. ...
-
bioRxiv - Neuroscience 2021Quote: TEER across cellular monolayers was measured with chopstick electrodes in 24-well Transwell inserts using the Millicell® ERS-2 Voltohmmeter (Merck Millipore). The absolute TEER of eGFP-hCldn5-MDCK II cells before treatment was recorded as a baseline reading ...
-
bioRxiv - Biochemistry 2021Quote: ... and subsequent thorough rinsing with ultrapure water (18.2 MΩ at 25 °C, maximum 2 ppb total organic carbon, Milli-Q Integral 5 Water Purification System, Merck KGaA, Darmstadt, Germany).
-
bioRxiv - Biochemistry 2020Quote: DNA encoding for Pry1 and Na-ASP-2 were PCR amplified and cloned into NcoI and XhoI restriction sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a pelB signal sequence to direct the secretion of expressed protein into the periplasmic space ...
-
bioRxiv - Plant Biology 2021Quote: ... 1000 μl tips were fitted with 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 10 μg of LiChroprep® RP-18 peptides (Merck). Tips were sequentially equilibrated with 100 % methanol ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracted peptides were dried in a speed-vac and resuspended in (v/v) 2% acetonitrile/0.2% trifluoroacetic acid (Merck, catalog no. 302031). A total of four biological replicates for each sample type was submitted.
-
bioRxiv - Neuroscience 2022Quote: ... were randomly assigned to receive an injection of 0.9% NaCl v/v 5-bromo-2’Deoxyuridine (BrdU) 100 mg/kg (MERCK; New York, USA) three times within the same day ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The protein was concentrated overnight to a volume of 2 mL in a Vivaspin 20 Ultrafiltration Unit (5 kDa MWCO)(Merck, Darmstadt, Germany) and then loaded onto a HiLoadTM 26/60 Superdex TM 75 prep grade (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... The total extract of proteins was then centrifuged for 20 min at 20,000 g and the soluble fraction loaded on an affinity chromatography with 2 ml of NiNTA resin (Sigma-Aldrich Merck, Darmstad Germany). The resin was washed with 20 ml of 20 mmol/L Tris-HCl (pH7.9 ...
-
bioRxiv - Microbiology 2021Quote: IFN-α and IFN-β or IL-6 and TNF-α were measured in supernatants of AMs or lung lysates using IFN alpha/IFN beta 2-Plex Mouse ProcartaPlex™ immunoassay (ebiosciences) or Milliplex MAP Mouse™ assay (Merck), respectively ...
-
bioRxiv - Genomics 2021Quote: ... Each lobe was segmented so cryosections would fit on the 6,200 x 6,400 µm areas of the Codelink-activated microscope slides and frozen in −30°C 2-Methylbutane (Merck, cat.no.: M32631-1L). The frozen liver samples were embedded in cryomolds (10×10 mm ...
-
bioRxiv - Plant Biology 2022Quote: ... disposable 200 μl pipette tips were fitted with 2 plugs of C18 octadecyl 47 mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were subjected to sonication on ice (10 cycles consisting of 10-s impulses at an output 10% followed by 20-s intervals) followed by incubation for 20 min at 37 °C in the presence of micrococcal nuclease (2 units/sample; Merck, cat. # N3755) and CaCl2 (at 10 mM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... (MW 360 kDa) and (Hydroxypropyl)-methylcellulose (HPMC) (viscosity 40-60 cP, 2 % in H2O (20 C) were purchased from Merck (Darmstadt, Germany). Methanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each lobe was segmented so cryosections would fit on the 6,200 x 6,400 µm areas of the Codelink-activated microscope or Visium slides and frozen in -30°C 2-Methylbutane (Merck, cat.no.: M32631-1L). For spatial experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated with 50 µM inhibitor (dissolved at 50 mM concentration in 100% DMSO) or 2 mM ATPψS (Merck Life Science UK) at room temperature for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture was grown for 2 hr at 37°C and stocks were made from the original plate by adding glycerol (Merck & Co., USA) to the final concentration of 15% and stored at -70°C ...
-
bioRxiv - Neuroscience 2023Quote: Blood was collected in 2 ml EDTA tubes that were prepared with 100µl protease inhibitor (Pefabloc® SC Plus, Merck KGaA, Germany). These tubes were centrifuged immediately after venepuncture for 15 min at 4⁰C and 3200g ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were concentrated to a volume of approximately 2 mL using Amicon® Ultra centrifugal filters with a NMWC of 10 kDa (cat# UFC801024, Merck Millipore).
-
bioRxiv - Neuroscience 2022Quote: ... freezed 15 min at −80°C and thawed for 15 min at room temperature following overnight incubation in 2% TritonX-100 (Merck Millipore, 1086031000) PBS for permeabilization ...