Labshake search
Citations for Merck :
251 - 300 of 998 citations for Adenovirus Type 5 Particles CMV Luciferase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Microbiology 2019Quote: ... The pellet was dissolved in three ul distilled water and spotted onto 5×5 cm silica gel plates (Merck) using automatic TLC sampler ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Microbiology 2022Quote: ... 0.1 mL of fixed cell suspension was filtrated by 0.22-µm pore-sized black polycarbonate filter (type GTBP; Merck Millipore, Darmstadt, Germany) and stained with 10 × SYBR Green I (SYBR® Green I Nucleic Acid Stain ...
-
bioRxiv - Cell Biology 2020Quote: DNA encoding wild-type and mutant versions of sLro1 were cloned into the BamHI and XhoI sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a PelB signal sequence to direct the secretion of the expressed protein into the periplasmic space ...
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... Mounted cells were fixed in 5% glutaraldehyde (Merck) in 0.1 M cacodylate (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Synthetic Biology 2021Quote: ... the diet for both the transgenic and wild-type strains was supplemented with CuSO4•5H2O (1 mM, Merck, CAS-no: 7758-99-9). Flies were reared in a controlled environment room at 25.0 °C ...
-
bioRxiv - Cell Biology 2022Quote: DNA encoding wild-type and the mutant version of PLIN3 were cloned into BamHI and NdeI restriction sites of pET16b vector (Novagen, Merck, Kenilworth, NJ, USA) using Gibson Assembly Cloning Kit (New England Biolabs ...