Labshake search
Citations for Merck :
251 - 300 of 6086 citations for 1 3 Nitro 10 11 dihydro 5H dibenzo b f azepin 5 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl, PH 8.3, both Merck) plus 0.05% Tween-20 (TBST ...
-
bioRxiv - Cancer Biology 2024Quote: ... each coverslip was washed with PBS 3 times each for 5 minutes and nuclei were stained with Hoechst (Merck Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... the slides were incubated with 5 % BSA in TBST supplemented with 10% goat serum (Merck) for 1 h at room temperature (RT) ...
-
bioRxiv - Immunology 2020Quote: ... recombinant FSH (Gonal-f 75 UI, Merck Serono Europe Limited, Spain), urinary human menopausal gonadotropin (hMG ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Genetics 2022Quote: ... 5 µg SA8 was dissolved in 10 µL 10 mM hydrochloric acid and digested with 20 ng/µL pepsin (Merck, cat. No. 10108057001) at 37 °C for 6 h ...
-
bioRxiv - Plant Biology 2021Quote: ... the washed seedlings were transferred into TetSee X solution (15% Na-deoxycholate, 25% urea, 10 % glycerol, 5% 2’2-thiodiethanol [Merck, Product No. 166782], 1% Triton X-100) and kept for 3 days at 4°C with daily changes of the TetSee X solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Biochemistry 2023Quote: ... and centrifuging in 10 K (3 K for dA) ultra-centrifugal filters Amicon® (Merck KGaA, Darmstadt, Germany). This process was repeated five times to dialyze the ligand ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM GSK-3 Inhibitor XVI (Merck, 361559) and 0.8 μM PD184352 (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... anti-total-α-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptor (anti-tAMPAR) (Cat.#AB1504, Merck Millipore, Burlington, MA, USA), anti-phospho (Ser845)-AMPAR (anti-pAMPAR;cat.#AB5849 ...
-
bioRxiv - Microbiology 2024Quote: ... hsa-miR-21-5p scramble microRNA mimic and a double-stranded small RNA oligonucleotide control (sequence: 5’- GGAACGCCAACCGAAGUCUA - 3’) (all from Merck) were added to achieve a final concentration of 250 nM on each well ...
-
bioRxiv - Biochemistry 2024Quote: Lipids (1 mg from the brain and 3–5 mg from the testis) were separated via TLC (Silica Gel 60 TLC plate, Merck) with methyl acetate/2-propanol/chloroform/methanol/0.25% calcium chloride in water (25:25:25:10:9 ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by signal development for 6–24 h in a solution containing nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Merck). The samples were covered with glass coverslips using CC/Mount (Merck) ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a multiplicity of infection (MOI) of 2–3 in the presence of 5 µg/ml polybrene (Hexadimethrine bromide, Merck). For creating stable SCC13 cell lines expressing YAP- or TAZ-targeting shRNAs ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Pb cells (∼40,000 per sample) were filtered onto 11 µm nylon filters (Merck Millipore NY1104700) to minimise residual bacteria ...
-
bioRxiv - Cell Biology 2021Quote: ... and 200 µg/mL Hygromycin B (Merck Millipore, 400052). Two hours before imaging of HeLa cells with Doxycycline-inducible expression of untagged Cidec or Cidec-SUMOstar ...
-
bioRxiv - Immunology 2021Quote: ... recombinant hepatitis B surface antigen (HBsAg) manufactured by Merck & Co. ...
-
bioRxiv - Immunology 2022Quote: ... amphotericin B deoxycholate (AmBD, Merck UK Ltd, Dorset UK), anti-Mala s 1 mouse monoclonal IgG1 antibody or mouse monoclonal IgG1 antibody isotype control was done by broth microdilution in a 96-well flat-bottomed plate (Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2LJμg/mL polymyxin B (Merck). Following staining ...
-
bioRxiv - Plant Biology 2023Quote: ... or Rosetta-gami B strains (all from Merck Millipore) and purified using Pierce Glutathione Magnetic Beads (Thermo Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... in the presence of 5000U/ml polymyxin B (Merck). Eggs were purified by centrifugation through 10ml percoll (GE Healthcare ...
-
bioRxiv - Biophysics 2021Quote: ... were first pre-treated with 5 and 10 μM concentrations of montelukast sodium hydrate (PHR1603, Merck) or saquinavir mesylate (1609829 ...
-
bioRxiv - Cancer Biology 2020Quote: ... media was replaced with media containing 10 nM 5-Bromo-2′-deoxyuridine (BrdU) (Merck, B5002-100MG). Coverslips were then fixed ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were deproteinized by addition of 10 μL of cold 5-sulphosalicilic acid (SSA, Merck) (300 mg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were treated with 10 μM DAPT and 5 μM Cytarabine (ARA-C) (Merck, Cat#C3350000) for 24 hours ...
-
bioRxiv - Microbiology 2022Quote: ... 50 and 70% for 5 min and 95% and 100% twice for 10 min (Merck Millipore). The coverslips were then critical-point-dried using an EM DPC 300 critical point drier (Leica ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were spotted on a 5 x 10 cm TLC silica gel 60 F254 (Merck) and developed in petroleum ether:diethyl ether (9:1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... reduced with 5 mM TCEP for 30 min and alkylated with 10 mM iodoacetamide (Merck, I1149) for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... Slides were mounted using a 3:1 solution of Canada balsam (Merck, # 1016910100) and Histoclear (HS-202 HISTO-CLEAR II ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
Highly amine-reactive graphene-oxide EM grids for biochemical surface modification in aqueous bufferbioRxiv - Molecular Biology 2023Quote: ... 4-Amino-1-butanol (#178330) and 3- glycidoxypropyltrimethoxysilane (#440167) were obtained from Merck. Gold nanoparticle- PEG-amine conjugate was custom-synthesized by NanoPartz (Loveland CO ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... or 1-octanol was used (1-OCT; CAS: 111-87-5; Merck, Darmstadt, Germany; undiluted). Paraffin is without behavioural significance in larval Drosophila (Saumweber et al ...
-
bioRxiv - Biophysics 2024Quote: ... branched PEI with 0.8 and 25 kg/mol (b-PEI0.8 and b-PEI25, respectively) were purchased from Merck (Codes 408719 and 408727, respectively), 50% w/aq ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Biophysics 2022Quote: ... was washed three times in Tris-buffer (pH 7.48) and resuspended in 1 %w/v Pluronic® F-127 (Merck Chemicals GmbH, Germany) Tris-Buffer.
-
bioRxiv - Immunology 2020Quote: ... rAAVDJ or rAAV6 genome plasmid and Donor plasmid at a 3:1:1 ratio in Polyethylenimine (PEI)(Merck). In total each plate was teransfected with 41,250ng of DNA ...
-
bioRxiv - Microbiology 2022Quote: ... and 10% ultra-pure water from Direct-Q 3 UV Water Purification System with LC-Pak Polisher (Merck KGaA) and mobile phase B was 10 mM ammonium acetate at pH 9 in ultra-pure water with 15 μM medronic acid (InfinityLab Deactivator additive ...
-
bioRxiv - Immunology 2022Quote: ... For intracellular cytokine labeling cells were incubated for 3 h at 37°C in RPMI-1640+10% FBS with PMA (10μg/ml, Merck), Ionomycin (1μg/ml ...