Labshake search
Citations for Merck :
2801 - 2850 of 3267 citations for Recombinant Human Intercellular Adhesion Molecule 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... the collagenase inhibitor Ilomastat ((R)-N′-Hydroxy-N-[(S)-2-indol-3-yl-1-(methylcarbamoyl)ethyl]-2-isobutylsuccinamide) (25μM, CC1010, Merck Millipore) or a combination of both ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Neuroscience 2021Quote: ... After washing the sections were incubated overnight at 4°C with anti-NeuN antibody (1:1000, Merck Millipore, Cat. # ABN90P) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Bioengineering 2021Quote: ... The cells were transduced with LV particles at low multiplicity of infection (MOI: 1-2) in the presence of 10 µg/mL of polybrene (Merck). HEK293T-EGFP were selected with 1 µg/mL of puromycin ...
-
bioRxiv - Bioengineering 2020Quote: ... we prepared a 1:1 (v/v) stock solution of MA+ in HBr by adding a methylammonium hydroxide (MAOH) solution (40% in H2O; Merck) dropwise into concentrated HBr ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissected tissue was placed in ice cold lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl pH 8, and cOmplete Mini Protease Inhibitor, Merck) and homogenized with a syringe and 20G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein pellets were resuspended in 120 μL PBS containing 1% SDS and desalted by passing through Amicon Ultra 0.5 mL 10K cutoff desalting columns (Merck Millipore) equilibrated with 1% NP-40 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies were detected with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000, #170-6515, Biorad or #12-349, Merck Millipore ...
-
bioRxiv - Systems Biology 2020Quote: ... The reaction was incubated at 25°C for 90 minutes followed by addition of 1 μL proteinase K (Merck, 3115887001) and incubation at 37°C for 10 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... then dialysed against the same stock of ITC buffer overnight at 4°C using 1 kDa Pur-a-lyzer tubes (Merck). Protein and RNA concentrations after dialysis were calculated by A280 and A260 absorbance respectively ...
-
bioRxiv - Microbiology 2021Quote: Polar metabolites were first extracted from the frozen SHIME-samples by means of ultra pure water (0,055 μS cm-1) obtained via a purified water system (VWR International, Merck, Germany). For this purpose ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 5% NGS and 0.5% Triton diluted in PBS and incubated over night at 4°C with primary antibody: rabbit anti-NG2 (1/50, AB5320, Merck), goat anti-PDGFRα (1/200 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were allowed to adhere in a 24-well plate with poly-L-lysine-coated glass coverslips for 1 hour (Merck). After infection with labelled A ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using the qScript cDNA SuperMix (Quantabio) from 1 μg total RNA previously treated with DNase I (Merck). For droplet generation ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: Reaction products and standards were dissolved in 20% 1-propanol and separated on a 10 cm HPTLC Si-60 plates (Merck) using 1-propanol:acetone:water 9:6:4 (v:v:v ...
-
bioRxiv - Genomics 2021Quote: Cultures of three Lasiodiplodia and five Neofusicoccum species (Table 1) were inoculated onto cellophane covered 2 % malt extract agar (MEA; Biolab, Merck) and incubated at 22 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The following day cancer cells were serum-deprived for 24h and then all cell lines were treated either with camptothecin 1-10μM (ref. C9911, CPT; Sigma-Merck, Argentina) or DMSO (ref ...
-
bioRxiv - Biophysics 2020Quote: ... The main peak fractions were pooled and concentrated to ∼1 mg/ml using an Amicon Ultra 100K filter (Merck Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... The blocks were then washed with DDW 2 times for 10 min and incubated in 1% (w/v) uranyl acetate (Merck)/70% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed and scraped in homemade Radioimmunoprecipitation assay buffer (RIPA) ((50 mM Tris pH 7.4, 150 mM NaCl, 1 % Triton X-100 (Merck, T9284), 2 mM EDTA ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membrane was incubated with secondary antibody for 1 hour at room temperature and proteins were detected using chemiluminescent HRP substrate (Merck-Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified ShTniQ was concentrated to 10 mg mL−1 using 10,000 kDa molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and non-expressing (d2EGFP−) cells were seeded into a 96 well plate pre-coated with 1 mg/ml Poly-D-Lysine (PDL, Merck). Aryl hydrocarbon receptor (AhR ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1 h at room temperature (RT) and revealed by chemiluminescence using Immobilon Crescendo or Forte Western HRP substrate (Millipore Merck).
-
bioRxiv - Microbiology 2022Quote: ... The membranes were blocked and incubated with primary antibodies against bornavirus P (1:500) and α-tubulin (Merck, Darmstadt, Germany), followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Biophysics 2022Quote: ... For the valine-labeled sample ketoisovalerate was added to a final concentration of 40 mg L-1 together with deuterated leucine (Merck) to a final concentration of 25 mg L-1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... permeabilized for 30 minutes at room temperature in PBS supplemented with 0.2% Triton X-100 and 1% Bovine Serum Albumin (BSA) and blocked for 30 minutes at room temperature in 10% donkey serum (all from Merck). Samples were stained overnight at 4°C with the primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Explants were cultured in 35 mm tissue culture dishes pre-coated with poly-L-lysine (20 µg/ml for 1 hr; Merck) and laminin (20 µg/ml for 1 hr ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Bioengineering 2021Quote: ... the cells were permeabilized with 60µL/well of 0.1% Triton X-100 for 10 minutes and stained with 50µL/well of DAPI (1:2000 dilution, in 1x PBST) (Merck, Germany) for 10 min [40] ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... “treated” cultures were grown with the addition of 0.25 µg ml-1 mitomycin C (MMC) (Merck Life Sciences UK Ltd). Mycelial pellets from untreated and treated cultures were washed in 1x PBS before lysis and RNA purification using the RNEasy Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... the Milliplex SARS-CoV-2 Antigen Panel 1 IgG was used according to the manufacturer’s instructions (Merck Millipore, Darmstadt, Germany).
-
bioRxiv - Synthetic Biology 2022Quote: ... Dialyzed samples were further concentrated to 10 mg mL-1 using Amicon® Ultra-15 Centrifugal Filter Unit (Merck Millipore). The final concentration of glycerol was adjusted to 50% (v/v% ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CM was concentrated to 1 ml at 4 °C using a 10 kDa Centricon Plus-70 centrifugal unit (Merck Millipore ...
-
bioRxiv - Biophysics 2019Quote: ... Oryzalin-treated inflorescence meristems were obtained from plants grown on custom-made Arabidopsis medium (40) (Duchefa) supplemented with 1% agar-agar (Merck) and 10 µM N-1-naphthylphthalamic acid (NPA ...
-
bioRxiv - Microbiology 2019Quote: ... and the pellet was resuspended in 0.1 M sodium acetate buffer (pH. 6) and dialysed against four changes of buffer using Amicon ultra centrifugal filters (Merck, Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lipid extracts corresponding to 1 mg wet liver weight were applied onto HPTLC silica gel 60 plates (10 × 20 cm: Merck) and plates were developed in n-hexane/diethylether/acetic acid 70:30:5 (v/v/v ...
-
bioRxiv - Synthetic Biology 2020Quote: ... All culture media were supplemented with either 20 g L−1 of D-glucose or maltose (both from Merck Millipore).
-
bioRxiv - Molecular Biology 2019Quote: ... followed by washing and staining with horseradish peroxidase-conjugated donkey anti-rabbit or anti-mouse IgG secondary antibodies (1:5,000 dilution; Merck Millipore), respectively ...
-
bioRxiv - Plant Biology 2020Quote: ... The inoculum concentration was adjusted to 106 spores mL-1 and the resulting spore suspension was supplemented with 0.1 % of Tween 20 (Merck, UK) prior to inoculation in the field ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were lysed in 500 μl of lysis buffer (8 mL of cold PBS and 2 mL of 10% Triton X-114 supplemented with Halt Protease inhibitor (1:100) and Bezonase (Merck) (1:1000)) ...
-
bioRxiv - Genetics 2021Quote: In vitro treatments were carried out with different compounds: 1 μM MG-132 24 hours or 3 hours (Merck Millipore), 20 μM Chloroquine (CQ ...
-
bioRxiv - Microbiology 2021Quote: Ago2 RIPs were performed on TREx-BCBL-1 RTA cells using EZ-Magna RIP RNA binding Immunoprecipitation Kit (Merck millipore) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Whole kidneys were homogenised in 250 mM sucrose / 20 mM triethanolamine with protease inhibitors (1% Merck Protease Inhibitor Cocktail III). The homogenate was cleared of large debris by centrifugation at 4000 g for 15 mins at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 mg of total protein at a 1 mg/ml concentration was incubated with 40 µl anti-FLAG-M2 affinity resin (Merck) (which had been blocked overnight with 1% BSA and 5 µl/ml ssDNA ...