Labshake search
Citations for Merck :
2751 - 2800 of 3149 citations for 6 Nitro 1 tetralone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1-oleoyl-2-acetyl-sn-glycerol (OAG) and 4α-phorbol 12,13-didecanoate (4α-PDD) were obtained from Merck (Gillingham, UK). Sphingosine-1-phosphate (S1P ...
-
bioRxiv - Neuroscience 2021Quote: ... MDMi cells were incubated with a primary antibody against Iba1 (1:1,000; 019-19744, FUJIFILM Wako Chemicals) in blocking buffer (2% bovine serum albumin, 0.1% TritonX100 (Merck, Darmstadt, Germany), and 5% normal donkey serum (017-000-121 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was eluted from the filter with 2 x 50 µl of Elution Buffer and 1 x 50 µl with DEPC-treated Molecular Biology Grade water (Merck). RNA samples were quantified with NanoDrop 2000 Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with MISSION® SiRNA oligomers or MISSION® siRNA Universal Negative Control #1 (Sigma Aldrich, Merck, USA) at a final concentration 20 nM ...
-
bioRxiv - Biochemistry 2022Quote: ... lysates were incubated with anti-HA agarose beads (20 μl of beads per 1 mg of proteins) (Merck, Darmstadt, Germany) for 2 h ...
-
bioRxiv - Immunology 2022Quote: Decidual cells were isolated as described above and incubated in the presence of fluorescence-labeled latex beads (50 beads per cell; latex beads, 1 µm, carboxylate-modified polystyrene, fluorescent yellow-green, Merck) for 2 hours at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were blocked for 30 min in 0.3 % Triton / 10 % normal goat serum / TBS followed by overnight primary antibody incubation (1:1000; rb TH; Merck Millipore) at 4 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were washed and incubated overnight at 4°C with anti-Digoxigenin-AP antibody (45-11093274910 Merck-SIGMA, 1:1000). Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Genetics 2022Quote: ... Transient transfection was carried out in HEK293T cells transfected with 1 μg of plasmid DNA in the presence of X-tremeGene9 DNA transfection reagent (#6365809001, Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... individuals were placed in 0.008% alizarin red (alizarin red S monohydrate, Waldeck Chemie, Münster, Germany) and 1% potassium hydroxide (EMSURE, Merck, Darmstadt, Germany) for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... the sections were treated with 10% methanol in PB for 20 min and then incubated for 1 h at RT in incubation buffer: 5% normal donkey serum (NDS: Merck) and 0.2% Triton X-100 (Merck ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 mL of filtered protein extract was mixed with 40μL of anti-FLAG M2 magnetic beads (Merck, formerly Sigma-Aldrich) (equilibrated in GTEN + 0.1 % Tween-20 prior to use ...
-
bioRxiv - Microbiology 2023Quote: ... Clarification was then performed by centrifugation for 1 hour at 12,000g and 4°C and vacuum filtration using 45um nylon filter systems (SteriFlip - Merck Millipore). Prior to purification ...
-
bioRxiv - Neuroscience 2022Quote: ... The dura was removed and a glass pipette connected to a Hamilton syringe containing LPC (1% in PBS; Merck, Germany) was lowered into the brain until 1.80 mm depth from the brain surface reaching into corpus callosum ...
-
bioRxiv - Molecular Biology 2022Quote: ... was assessed before and after induction with Doxycycline (1 μg/mL) by Western blot analysis using an anti-FANCJ (cat. B1310, Merck) and/or an anti-Flag antibody.
-
bioRxiv - Neuroscience 2022Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 2 ml 4 °C PBS for 3 times and afterwards fixed in 1 ml of −20 °C cold methanol (Gradient grade for liquid chromatography, Merck) for 5 minutes at −20 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... were sonicated in 1 M KOH solution (6592-3705, Daejung) for 30 min and then washed with Milli-Q water (Direct 8, Merck) to remove remaining KOH solution ...
-
bioRxiv - Microbiology 2022Quote: ... wells were washed twice with warm PBS before incubation in 500 μL pre- warmed DMEM with 1% (v/v) Nutridoma (Merck) supplemented with 5 μM clickable sphingosine (Cayman Chemical ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed with 1% BSA/PBS and subjected to the Click-iT reaction in a solution containing 10 mM sodium ascorbate (Merck), 0.1 mM azide-PEG3-biotin conjugate (Merck ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U mL−1 benzonase (Merck). After 1 h incubation at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... and pcDNA5/FRT/TO/2K-NS4B-3xFLAG-APEX2 in 9:1 (w/w) ratio using GeneJuice transfecting agent (Sigma-Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The lyophilized peptides were resolubilized in 80 % acetone with 1 % TFA and loaded onto an ihouse ZIC-HILIC micro-column containing 30 mg of ZIC-HILIC particles (Merck Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in T cell medium for 30 min at 37°C without any metabolic inhibitors or in presence of 1 μM oligomycin (Merck), 100 mM 2DG (Merck) ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies (table 1) were added in 5% milk TBS-T and membranes were developed using ECL luminol kit (Merck) and chemiluminescence films (Amersham Hyperfilm ECL ...
-
bioRxiv - Neuroscience 2024Quote: ... Three baseline recordings were taken followed by three recordings after each of the following subsequent injections: 1 μM Oligomycin (Merck), 1 μM FCCP (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffer was exchanged for 1× DPBS and LNPs were concentrated by centrifugation on Amicon 50 kDa filter unit (Merck #UFC805024). Size distribution and polydispersity index were determined using dynamic light scattering on Zetasizer Ultra Red (Malvern ...
-
Insight into the regulatory mechanism of the MFS transporter, SCO4121 by the MarR regulator, SCO4122bioRxiv - Molecular Biology 2024Quote: ... the MSA agar plate was flooded and 500 µg/ml of nalidixic acid (Himedia) and 1 mg/ml of apramycin (Merck). After incubation ...
-
bioRxiv - Neuroscience 2024Quote: ... or Tris-HCl buffered saline (TBS) and incubated at 4°C overnight with primary antibodies (anti-Nr4a2, Abcam, ab41917, 1:500 dilution; anti-GluA1, Merck-Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... the A549 cells were washed once with 1× phosphate-buffered saline (PBS) before incubating again with 100 µL of 0.5 mg/mL of MTT reagent (Merck, Germany) for 3 h at 37°C to allow the formation of purple formazan ...
-
bioRxiv - Microbiology 2024Quote: ... The pellet was resuspended in RNA solubilization buffer (20 mM dithiothreitol (Vivantis, Malaysia) and 1 mM sodium citrate (Merck, Germany). The yield and purity were determined with a BioDrop Spectrophotometer Duo (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: ... and Pb external calibrations were prepared from 1 g/L stock solutions (Carl Roth, Centipur® Merck, or VHG Labs). Se was quantified by isotope dilution analysis (IDA ...
-
bioRxiv - Microbiology 2023Quote: ... Fractions corresponding to CVB5 were combined and concentrated to 4.5 mg ml-1 using Amicon Ultra centrifugal filter units with 100 kDa MWCO (Merck Millipore).
-
bioRxiv - Neuroscience 2023Quote: ... Plates were washed three times with 0.1% PBST and incubated at RT for 1 hour with horseradish peroxidase-conjugated secondary antibody (Cat No. NA934, Merck Millipore) diluted 1:1,000 in 0.05% PBST ...
-
bioRxiv - Neuroscience 2022Quote: ... whole plasmids (Entry plasmids containing cmk-1 coding DNA sequences) were amplified with the KOD Hot Start DNA Polymerase (Novagen, Merck). Primers were phosphorylated in 5’ and were designed to contain the desired point mutation(s ...
-
bioRxiv - Microbiology 2023Quote: ... binding of equine antibodies was detected by incubation for 1 hour with protein A conjugated to peroxidase (GE) and visualized with chemiluminescence reagent (ECL, Merck). Images were obtained with an Odyssey LI-COR instrument ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 50 µL chloroform : methanol (2 : 1) and 5 µL were loaded on silica gel 60 F254 plates (Merck). To separate trehalose esters of mycolates (TDM ...
-
bioRxiv - Developmental Biology 2023Quote: ... Product number E4250) (1 mg/ml) to contract pigment cells alongside 0.01% Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich (Merck) Product number E10521 ...
-
bioRxiv - Cell Biology 2023Quote: ... APTS-labelled glycans were prepared for xCGE-LIF in a 1:10 dilution in water (water for chromatography, LC-MS grade, Merck) and mixed with 1 µl GeneScan™ 500 LIZ™ dye Size Standard (1:50 dilution in HiDi™ Formamide ...
-
bioRxiv - Biochemistry 2023Quote: ... Peak fractions were concentrated to 2.2 mg mL-1 using 100 kDa molecular weight cut-off centrifugal filters (Merck Millipore). To each 300-mesh holey carbon grid (Au R1.2/1.3 ...
-
bioRxiv - Evolutionary Biology 2023Quote: The frozen cell pellet was homogenized in RIPA buffer (Fujifilm, Osaka, Japan) containing 1/100 (v/v) in a final volume of Protease Inhibitor Cocktail (Merck) for 30 min at 4 °C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Japan) in 1× PBS for 20 min at room temperature and then incubated with the anti-ADAR antibody HPA051519 (Merck) diluted 1:200 with PBS for 12 h at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... The pre-adipocytes were plated in custom-made plates (Supp. Fig. 15b) and cultured in growth medium -low glucose (1g l-1) DMEM (Merck) supplemented with 10% FBS (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C then moved to 37°C and incubated for 1 h with or without 100 µM cytochalasin D (Merck), 100 µM jasplakinolide (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were blocked with 5% BSA in TSMT (20 mM Tris; 150 mM NaCl, Merck; 1 mM CaCl2, Sigma; 2 mM MgCl2, Merck; adjusted to pH 7 with HCl ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were incubated for 1 h at RT with a mouse anti-2A primary antibody (cat. no. MABS2005, Merck) diluted 1:2000 in 1% (w/v ...
-
bioRxiv - Cell Biology 2023Quote: Proximity ligation assays with Aurora A kinase and MP-GAP were performed in HeLa cells using mouse anti-Aurora A Kinase antibody (1:500, A1231 Merck), rabbit anti-MP-GAP antibody (1:250 ...
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...