Labshake search
Citations for Merck :
2701 - 2750 of 3899 citations for 1 1 Ethynylcyclohexyl azetidin 1 ium 3 yl n naphthalen 1 ylcarbamatechloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... 250 ng of each plasmid encoding VN and VC were transfected using 4 μL of 1 μg/mL PEI (Merck) for each μg of DNA ...
-
bioRxiv - Biophysics 2021Quote: ... fluorescently-labeled and biotinylated H57-scFV were concentrated to 0.2 - 1 mg/mL with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cells were transferred to a hypoxia chamber (InvivO2, Baker Ruskinn) set at 1% O2 and treated with increasing concentrations of PT2399 (Peloton Therapeutics/Merck) for 48 hours 22 ...
-
bioRxiv - Microbiology 2020Quote: ... After 2 hours at 30°C with shaking 1 ml of cells was pelleted and soluble proteins were extracted using BugBuster (Merck). For internalisation experiments involving plasmid-complemented deletion strains ...
-
bioRxiv - Molecular Biology 2021Quote: ... The sample (0.5-1 ml) was transferred to Amicon Ultra 0.5 ml Centrifugal Filters (MWCO=30 kDa, Merck, cat# UFC503096) and further concentrated to a final volume of 200 μl.
-
bioRxiv - Evolutionary Biology 2020Quote: ... followed by incubation with a secondary Cy3-labeled polyclonal goat anti-rabbit antibody (AP132C, 1:800, Merck Millipore, Burlington, USA). Cells were mounted on slides using Fluoroshield™ with DAPI mounting medium (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and transferred into polyvinylidene difluoride (PVDF) membrane in 1× Transfer buffer (Tris-base/Glycine/Methanol, Sigma-Aldrich/Merck, Poznan, Poland) using the Mini Trans-Blot® system (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... the sections were incubated overnight with a primary antibody mixture of guinea pig anti-glycine transporter 2 (GlyT2; 1:10,000; AB1773, Merck, RRID:AB_90953) and mouse anti-GAD67 (1 µg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... was diluted (1:1000) in 500 μl 0.1% PBST with 0.2% normal donkey serum (S30-100ML, Merck Millipore, Hertfordshire, UK) and sections were protected from light and incubated at RT with agitation for 2 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were incubated with a solution containing 1/50 phalloidin alexa fluor 488 in PBST supplemented with 5% DMSO (Merck) and covered with parafilm (Bemis ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial inoculums were subsequently prepared using the direct colony suspension method.40 Three to five bacterial colonies were obtained from the agar plate and inoculated into an Eppendorf tube containing 1 ml of cation-adjusted Muller-Hinton broth (caMHB, Merck), consisting of 20-25 mg/L calcium ions (Ca2+ ...
-
bioRxiv - Plant Biology 2020Quote: Frozen cell pellets harvested from approximately 1 L of suspension cultures were crushed with quartz fine granules (Merck, Darmstadt, Germany) with a precooled mortar and pestle in ice-cold lysis buffer (25 mM Tris ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... for 39 weeks alone and in combination with a specific inhibitor of mPGES-1 (MF970, 10 mg/ Kg BW; a kind gift of Merck). BP was measured using the tail-cuff system as mentioned ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Neuroscience 2021Quote: ... After washing the sections were incubated overnight at 4°C with anti-NeuN antibody (1:1000, Merck Millipore, Cat. # ABN90P) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Bioengineering 2021Quote: Isolation of fresh human PBMCs was initiated within 1 h after blood collection using Histopaque® 1077 (10771; Merck KGaA) and standard density centrifugation (800 rcf ...
-
bioRxiv - Bioengineering 2021Quote: ... The cells were transduced with LV particles at low multiplicity of infection (MOI: 1-2) in the presence of 10 µg/mL of polybrene (Merck). HEK293T-EGFP were selected with 1 µg/mL of puromycin ...
-
bioRxiv - Bioengineering 2020Quote: ... we prepared a 1:1 (v/v) stock solution of MA+ in HBr by adding a methylammonium hydroxide (MAOH) solution (40% in H2O; Merck) dropwise into concentrated HBr ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were mounted on slides and covered with an anti-fading medium using a mix solution 1:10 Propyl-gallate:Mowiol (P3130, SIGMA-Aldrich, Madrid, Spain; 475904, MERCK-Millipore ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Dissected tissue was placed in ice cold lysis buffer (150 mM NaCl, 1% NP-40, 50 mM Tris-HCl pH 8, and cOmplete Mini Protease Inhibitor, Merck) and homogenized with a syringe and 20G needle ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein pellets were resuspended in 120 μL PBS containing 1% SDS and desalted by passing through Amicon Ultra 0.5 mL 10K cutoff desalting columns (Merck Millipore) equilibrated with 1% NP-40 ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibodies were detected with a horseradish peroxidase (HRP)-conjugated secondary antibody (1:3000, #170-6515, Biorad or #12-349, Merck Millipore ...
-
bioRxiv - Systems Biology 2020Quote: ... The reaction was incubated at 25°C for 90 minutes followed by addition of 1 μL proteinase K (Merck, 3115887001) and incubation at 37°C for 10 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... then dialysed against the same stock of ITC buffer overnight at 4°C using 1 kDa Pur-a-lyzer tubes (Merck). Protein and RNA concentrations after dialysis were calculated by A280 and A260 absorbance respectively ...
-
bioRxiv - Microbiology 2021Quote: Polar metabolites were first extracted from the frozen SHIME-samples by means of ultra pure water (0,055 μS cm-1) obtained via a purified water system (VWR International, Merck, Germany). For this purpose ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 5% NGS and 0.5% Triton diluted in PBS and incubated over night at 4°C with primary antibody: rabbit anti-NG2 (1/50, AB5320, Merck), goat anti-PDGFRα (1/200 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were allowed to adhere in a 24-well plate with poly-L-lysine-coated glass coverslips for 1 hour (Merck). After infection with labelled A ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized using the qScript cDNA SuperMix (Quantabio) from 1 μg total RNA previously treated with DNase I (Merck). For droplet generation ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Sections containing SN and VTA were incubated with antibodies directed against tyrosine hydroxylase (mouse monoclonal, 1:1000, Merck-Millipore MAB318) and mCherry (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: Reaction products and standards were dissolved in 20% 1-propanol and separated on a 10 cm HPTLC Si-60 plates (Merck) using 1-propanol:acetone:water 9:6:4 (v:v:v ...
-
bioRxiv - Genomics 2021Quote: Cultures of three Lasiodiplodia and five Neofusicoccum species (Table 1) were inoculated onto cellophane covered 2 % malt extract agar (MEA; Biolab, Merck) and incubated at 22 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The following day cancer cells were serum-deprived for 24h and then all cell lines were treated either with camptothecin 1-10μM (ref. C9911, CPT; Sigma-Merck, Argentina) or DMSO (ref ...
-
bioRxiv - Biophysics 2020Quote: ... The main peak fractions were pooled and concentrated to ∼1 mg/ml using an Amicon Ultra 100K filter (Merck Millipore).
-
bioRxiv - Cell Biology 2021Quote: ... The blocks were then washed with DDW 2 times for 10 min and incubated in 1% (w/v) uranyl acetate (Merck)/70% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: Cells were lysed and scraped in homemade Radioimmunoprecipitation assay buffer (RIPA) ((50 mM Tris pH 7.4, 150 mM NaCl, 1 % Triton X-100 (Merck, T9284), 2 mM EDTA ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membrane was incubated with secondary antibody for 1 hour at room temperature and proteins were detected using chemiluminescent HRP substrate (Merck-Millipore ...
-
bioRxiv - Biochemistry 2022Quote: ... Purified ShTniQ was concentrated to 10 mg mL−1 using 10,000 kDa molecular weight cut-off centrifugal filters (Merck Millipore) and flash-frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and non-expressing (d2EGFP−) cells were seeded into a 96 well plate pre-coated with 1 mg/ml Poly-D-Lysine (PDL, Merck). Aryl hydrocarbon receptor (AhR ...
-
bioRxiv - Cell Biology 2022Quote: ... for 1 h at room temperature (RT) and revealed by chemiluminescence using Immobilon Crescendo or Forte Western HRP substrate (Millipore Merck).
-
bioRxiv - Microbiology 2022Quote: ... The membranes were blocked and incubated with primary antibodies against bornavirus P (1:500) and α-tubulin (Merck, Darmstadt, Germany), followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson ImmunoResearch ...
-
bioRxiv - Biophysics 2022Quote: ... For the valine-labeled sample ketoisovalerate was added to a final concentration of 40 mg L-1 together with deuterated leucine (Merck) to a final concentration of 25 mg L-1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... permeabilized for 30 minutes at room temperature in PBS supplemented with 0.2% Triton X-100 and 1% Bovine Serum Albumin (BSA) and blocked for 30 minutes at room temperature in 10% donkey serum (all from Merck). Samples were stained overnight at 4°C with the primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Explants were cultured in 35 mm tissue culture dishes pre-coated with poly-L-lysine (20 µg/ml for 1 hr; Merck) and laminin (20 µg/ml for 1 hr ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Bioengineering 2021Quote: ... the cells were permeabilized with 60µL/well of 0.1% Triton X-100 for 10 minutes and stained with 50µL/well of DAPI (1:2000 dilution, in 1x PBST) (Merck, Germany) for 10 min [40] ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse monoclonal β-actin antibody (1:1000 dilution; catalog no. catalog no. MAB 1501; Merck Millipore, Burlington, MA, USA) at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: ... “treated” cultures were grown with the addition of 0.25 µg ml-1 mitomycin C (MMC) (Merck Life Sciences UK Ltd). Mycelial pellets from untreated and treated cultures were washed in 1x PBS before lysis and RNA purification using the RNEasy Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... the Milliplex SARS-CoV-2 Antigen Panel 1 IgG was used according to the manufacturer’s instructions (Merck Millipore, Darmstadt, Germany).