Labshake search
Citations for Merck :
2501 - 2550 of 4877 citations for 7 Oxabicyclo 4.1.0 heptane 2 carboxylicacid 6 ethyl 1 methyl 5 oxo ethylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Fragments (2 mM in DMSO) were injected (2 μL) onto a Purospher STAR RP-18 end-capped column (3 μm, 30 × 4 mm, Merck KGaA). Chromatographic separation was carried out over a 4-min gradient elution (90:10 to 10:90 water:methanol ...
-
bioRxiv - Plant Biology 2020Quote: ... tumefaciens were resuspended in 50 mM MES (2-Morpholinoethanesulfonic acid hydrate) (Duchefa, Haarlem, The Netherlands) - KOH buffer (pH 5.6) containing 2mM NaH2PO4 (Merck, Darmstadt, Germany), 100 µM acetosyringone (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... used for barrier dysfunction experiments were conducted on a 37 °C heating block using a Millicell ERS-2 Voltohmmeter (Merck-Millipore) equipped with an Ag/AgCl electrode (STX01) ...
-
bioRxiv - Molecular Biology 2021Quote: TEER measurements [22] were performed on 3rd day of incubation with growth factors and (or) different inhibitors by using Millicell ERS-2 Electrical Resistance System (Merck-Millipore). Each insert was measured in three different locations ...
-
bioRxiv - Molecular Biology 2020Quote: ... we repeated the experimental protocol and behavioral battery in wild type zebrafish larvae using 2 μM THC (Merck, Cat. No. T4764), and 0.15 μM nicotine (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... Fractions containing the desired His6-tagged protein were concentrated to 2 ml using Amicon® Ultra Centrifugal Filters (10,000 MWCO, Merck Millipore), and were directly injected into a size-exclusion chromatography column (Superdex 75 16/60 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 2 μl of the enzyme β-glucuronidase (from Helix from Pomatia enzyme aqueous solution, ≥ 100.000 units/mL; Merck, Darmstadt, Germany) to deconjugate DEHP metabolites and BPA ...
-
bioRxiv - Immunology 2021Quote: ... tumors were enzymatically digested with 2,000 U/mL of DNase I and 2 mg/mL of collagenase IV (both from Sigma Aldrich, Merck, Israel) in HBSS for 30 min 37 □ ...
-
bioRxiv - Neuroscience 2021Quote: ... the kinetics of ROS production was evaluated for 2 h after the addition of 2,7-dichloro-diidrofluorescineacetate (DCFH-DA, Merck, Darmstadt, Germany) using the Microplate Reader GloMax fluorimeter (Promega Corporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fractions corresponding to the elution peak were selected and concentrated to 2-50 mg/mL through the use of Amicon® Ultra-15 Centrifugal Unit (Merck), frozen and stored at −80°C for downstream experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... femurs and tibias of C57BL/6J mice were extracted and crushed on a mortar in PBS supplemented with 4%FBS and 2 mM EDTA and filtered through 0.45μm strainers (Merck Millipore, Cat#SLHV033RB). For B cells ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 plugs of C18 octadecyl 47mm Disks 2215 (Empore™) material and 1mg:10 μg of LiChroprep® RP-18 (Merck) ...
-
bioRxiv - Zoology 2023Quote: ... it was fractionated into the different fatty acid classes over an activated silicic acid column (heated at 120ºC for 2 h; Merck Kieselgel 60) via eluting with 7 ml chloroform ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed with 2% paraformaldehyde for 10 min at room temperature and stained with the Hemacolor Rapid Staining Kit (Merck Millipore). Images were collected on BX61 upright microscope (Olympus ...
-
bioRxiv - Microbiology 2024Quote: ... Transconjugant colonies carrying pCPE16_3blaNDM-1 were selected on LB agar supplemented with 300 µg/mL hygromycin B (PhytoTech Labs, USA) and 2 µg/mL doripenem (Merck, Germany). Conjugation frequencies were calculated using the following formula: Data shown are the mean ± standard deviation of three independent experiments ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sample volumes of the adhesive tape samples were reduced to 200 µL using Amicon Ultra-2 30K tubes (Merck, section 2.3.9).
-
bioRxiv - Molecular Biology 2024Quote: Serum-free media from transfected HEK293T was concentrated to about 2 ml with Amicon Ultra-15 Centrifugal Filter 10 kDa MWCO (Merck Millipore) at 3,000 rcf for 15-20 min ...
-
bioRxiv - Immunology 2024Quote: Net ALI membrane resistance for each sample was determined by measuring the sample resistance with a MillicellERS-2 Voltohmmeter (Merck Millipore) then subtracting the blank sample resistance reading ...
-
Macropinocytosis mediates resistance to loss of glutamine transport in triple-negative breast cancerbioRxiv - Cancer Biology 2024Quote: ... Negative control lines ‘NC’ and ‘NC#2’ were generated with U6gRNA-pCMV-Cas9–2A-GFP containing the guide tatgtgcggcaaaccaagcg (CRISPR08; Sigma-Aldrich/Merck). For three days prior to transfection ...
-
bioRxiv - Plant Biology 2023Quote: ... and incubated at 28°C shaking at 200 rpm for 2–3 h before plating on LB agar supplemented with 50 µg/ml Kanamycin (Merck Millipore). The plates were incubated for 2– 3 days at 28°C ...
-
bioRxiv - Cell Biology 2023Quote: ... produced by the mix of 50 ml of sodium hypochlorite 10% (Roth, ref. 9062.3) and 2 ml of 37% hydrochloric acid (Merck, ref. 1.00317.1000). Seeds were then aerated for 10 min in a sterile bench to remove the left-over chlorine gas ...
-
bioRxiv - Plant Biology 2023Quote: ... from 25 plants were transferred into a Teflon vessel and digested with 2 mL of 65% HNO3 and 0.5 mL H2O2 (Suprapur; Merck, Darmstadt, Germany) in a MarsXpress microwave digestion system (CEM ...
-
bioRxiv - Microbiology 2023Quote: ... 10 pylorus and ileum sections from bees coming from the same cage were pooled in a 2 ml screw cap tube containing 750 μl of TRI reagent (Sigma-Aldrich, Merck), glass beads (0.75-1 mm diameter ...
-
bioRxiv - Microbiology 2023Quote: MDCK cells (2 x 105 cells) were cultured on polycarbonate Millicell culture plate inserts (12- mm diameter, 3-µm pore size; Merck Millipore) at 37°C under 5% CO2 atmosphere.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... followed by washing with 1XPBS two times for 2’ each and blocked again with Biotin (0.001%, Sigma-Aldrich, Merck, Overijse, Belgium) for 20’ and washed twice for 2’ in 1XPBS each ...
-
bioRxiv - Neuroscience 2023Quote: ... and the supernatant obtained was spotted 2 μl on the origin point of a reversed-phase plate (RP-18, Merck Millipore) and developed with a mixture solution of acetonitrile ...
-
bioRxiv - Plant Biology 2024Quote: ... Pto DC3000 ΔavrPto ΔavrPtoB was cultured in NYG-medium (0.5% [w/v] peptone, 0.3% [w/v] yeast extract, 2% [v/v] glycerol; Merck KGaA, Darmstadt, Germany) with appropriate antibiotics (50 µg/ml rifampicin ...
-
bioRxiv - Neuroscience 2024Quote: ... the elution of the biotinylated proteins was carried out boiling the beads in 25 μl of 3X protein loading buffer supplemented with 20 mM DTT and 2 mM Biotin (Merck, B4501) for 10 min at 95°C in gentle shaking ...
-
bioRxiv - Neuroscience 2020Quote: ... antigen retrieval and antibody staining (anti-PER2, Alpha Diagnostic, cat. PER21-A, 1:200 dilution; anti-GFAP, Abcam, cat. ab53554, 1:500 dilution; anti-NeuN, Merck Millipore, cat. mab377, 1:250 dilution). The procedures have been described by our laboratory in detail elsewhere (Brenna et al. ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... and incubated with the primary antibody (cofilin, Cell Signaling, cat. 5175S, 1:3000; HA-Tag, Santa Cruz, sc-7392, 1:1000; GAPDH, Merck Millipor, No. AB2302, 1:2000) for 12 hours ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 mM MgCl2) containing 1% BSA and incubated overnight with the G4-specific antibody (BG4, MABE917, Merck) at 500 ng/mL in BG4 buffer containing 1% BSA ...
-
bioRxiv - Genetics 2019Quote: ... rabbit anti-TbRBP16 [1:1,000] (27) and mouse anti-EF1a [1:200,000] (clone CBP-KK1, Merck-Millipore) for 18 h at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... in the presence of enzymatic digestion solution containing 1 mg ml-1 collagenase II (Merck Millipore, 234155), 1 mg ml-1collagenase IV (Merck Millipore ...
-
bioRxiv - Immunology 2021Quote: ... The membrane was blocked for 1 hour in PBS supplemented with 1% Tween-20 (Merck MP Biomedicals) and 5% skimmed milk (Friesland Campina) ...
-
bioRxiv - Developmental Biology 2022Quote: ... different concentrations from 1:10 to 1:10000 (V/V) were freshly diluted in absolute ethanol (Merck). For NaCl chemotaxis ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:600-diluted rabbit anti-CENP-C (#554),55 mouse anti-HP1α (1:1,000, #MAB3584, Merck Millipore), rabbit anti-HP1β (1:800 ...
-
bioRxiv - Neuroscience 2024Quote: ... Postfixation was applied using 1% Osmiumtetroxid (Science Services, München, Germany) and 1% Potassium hexacyanoferrat (Merck, Darmstadt, Germany) for 30 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... diluted 1 : 100 in 1 × PBS buffer (pH 7.5) with 0.1 % hydrogen peroxide (stock concentration 30 %, Merck) and 2 mM ATP (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... the blots were incubated with primary antibodies α-FLAG (Merck, F1804, 1:1000], α-TPLATE34(1:1000), α-AtEH1/Pan135(1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Ki67 (rabbit, 1:400, CST, Cat. no 9661S) and cCas3 (rabbit, 1:600, Merck, Cat. no AB9260). The cells were fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Biochemistry 2024Quote: ... We loaded 10 µL of protein mixed in a 1:1 ratio with Laemmli 2x Concentrate (Merck). The gel was ran for 35min at 200V with Tris/Glycine/SDS buffer (BIORAD ...
-
bioRxiv - Neuroscience 2024Quote: ... or α-tubulin (1:1000; 12G10) and rabbit polyclonal antibodies against detyrosinated tubulin (1:10000, AB3021, Merck) and 3-NT (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... diluted 1:1 (v:v) with water containing 4 mM MgCl2 and benzonase (Merck #70746, 250 U/µl), and incubated for 15 min at RT to digest nucleic acids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 mM TCEP) and concentrated to approximately 5 ml using an Amicon® Ultra Centrifugal Filter Ultracel®-3K (UFC900324, Merck/Millipore, Darmstadt, Germany) before loading onto a HiTrap™-Heparin HP column (Cytiva ...
-
bioRxiv - Microbiology 2020Quote: ... spores were collected from 5-day-old cultures NO3 medium (0.17% yeast nitrogen base, 3% sucrose, 100mM KNO3) by filtering through miracloth (Merck; pore size of 22–25μm). Spores were centrifuged ...
-
bioRxiv - Immunology 2020Quote: Following protein digestion a 5% volume of the peptide solution was cleaned up with a reverse phase (C18) ZipTip (Merck Millipore, Burlington, MA, USA). The peptide sample was acidified with the addition of 1 μl 1M hydrochloric acid ...
-
bioRxiv - Immunology 2022Quote: ... Tissue samples for RNA-protein extraction were cut into small pieces (< 5 mm) and placed in a microcentrifuge tube containing RNAlater® solution (Merck Ltd, Dorset, UK) and stored at −70°C until further use.
-
bioRxiv - Neuroscience 2024Quote: ... each sample was separated on 5-20% gradient e-PAGEL mini gels (ATTO Corporation, Tokyo, Japan) and transferred to polyvinylidene fluoride membranes (Merck Millipore, Billerica, MA, USA). The membranes were incubated for 30 min with blocking buffer (Nacalai Tesque) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: HPLC separations were performed on a Waters 2695 separations module equipped with a Waters 2996 photodiode array detector and HPLC analysis was carried out using a LiChrospher® 100 RP-18 column (4 mm × 250 mm, 5 μm) (Merck, Kenilworth, NJ, USA). The mobile phase consisted of two solvent reservoirs ...
-
bioRxiv - Biochemistry 2021Quote: ... PTP1B KO Ramos were transfected with a doxycycline inducible tet-on vector and exposed to 2 μg/ml doxycycline (Calbiochem, Merck, Darmstadt, Germany) 24 to 48 h before the experiment ...