Labshake search
Citations for Merck :
201 - 250 of 290 citations for Human ADH5 siRNA since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: The sEVs used to validate the platform were collected from a commercial human serum purchased from Merck Millipore (same lot in all preparations ...
-
bioRxiv - Neuroscience 2021Quote: ... Injections of 50 µl NGF at a concentration of 0.8 µM (NGF, human recombinant, Calbiochem, Merck, Germany) dissolved in phosphate buffer saline (PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... The concentrations of Aβ40 and Aβ42 were determined in brain lysates using the ELISA kits according to the manufacturer’s instructions (human Aβ40 and Aβ42 brain ELISA, Merck).
-
bioRxiv - Genomics 2022Quote: ... females and males were primed with 20 U and 10 U human chorionic gonadotropin (hCG, Pregnyl, Merck), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Human peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll density gradient centrifugation (GE-171440-02, Merck), collected from the interphase ...
-
bioRxiv - Neuroscience 2022Quote: ... C3 and C1 were analyzed with HCMP2MAG-19K-02 Human Complement Magnetic Bead Panel 2 (Merck Millipore). Supernatants from non-stimulated CTL and L2-PD astrocytes cultured for 14 days were collected and stored at −80°C for long storage ...
-
bioRxiv - Cell Biology 2023Quote: ... fully mature Xenopus females were injected with 260 U of human chorionic gonadotropin (hCG; Merck, Ovitrelle 250G) into the dorsal lymph sac about 12-16 h before use and kept overnight at 18 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 400 µl of solution of recombinant TnC (Supplementary Materials and Methods) or purified human TnC (Merck Millipore) (15 µg/ml in 0.01% PBS-Tween ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were sub-cultured on days 4 and 8 of differentiation onto human fibronectin (Merck Millipore, #FC010) coated plates at a ratio of 1:4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were treated with 10 ng/ml of the recombinant human TNFα protein (Merck-Millipore, Cat# GF023) and the outcome was assessed at RNA or protein levels.
-
bioRxiv - Immunology 2024Quote: ... we used anti-human TIM-3 IgG4 antibody (5 μg/ml, Merck & Co., Inc., Rahway, NJ, USA). Finally ...
-
bioRxiv - Microbiology 2024Quote: ... Human miR-21 (hsa-miR-21-5p, Sequence: 5’ – UAGCUUAUCAGACUGAUGUUGA - 3’; HMI0371 MISSION® microRNA Mimic, Merck), or miR-21 scramble control (Sequence ...
-
bioRxiv - Cell Biology 2024Quote: The EMD MILLIPLEX® MAP Human Cytokine/Chemokine/Growth Factor Pane A – Immunology Multiplex Assay (Merck Millipore) was employed to simultaneously analyze TNF-α ...
-
bioRxiv - Neuroscience 2020Quote: ... RIPA and FA fractions was assessed using the Human Aβ1-42 enzyme-linked immunosorbent assay (ELISA) Kit (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: Primary human macrophages (pMФ) were isolated from the whole blood of healthy volunteers with Biocoll separating solution (Merck) according to the manufacturer’s protocol and seeded at a density of 2×106 cells per well in a 6-well plate ...
-
bioRxiv - Biochemistry 2020Quote: ... Human Rab8a 6-176aa (referred to as Rab8a)-encoding DNA was cloned into a pet51b(+) vector (Merck Millipore), resulting in a construct with a N-terminal Strep® II tag and enterokinase cleavage site and a C-terminal 10xHis tag ...
-
bioRxiv - Biochemistry 2020Quote: ... at increasing concentrations (3.8 pM–250 nM) in the presence of 90% heat-inactivated human serum (H5667, Merck) and incubated at 4 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... The human macrophage-like cell line U937 (ATCC no. CRL-1593.2) was cultured in RPMI-1640 medium (Merck) supplemented with 10% iFCS ...
-
bioRxiv - Cell Biology 2021Quote: Human hTERT RPE-1 cells (ATCC, CRL-4000) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM/F12, Merck) supplemented with 10% fetal calf serum (FCS) ...
-
bioRxiv - Bioengineering 2022Quote: ... Human brain endothelial cell line (hCMEC/D3) and EndoGRO™ MV cell medium kit were purchased from Merck-Millipore (MA ...
-
bioRxiv - Immunology 2022Quote: ... Animals were randomly assigned to be treated with either 170,000 IU/kg human recombinant interferon alpha-2a (Merck), or BSA/saline (0.9% NaCl ...
-
bioRxiv - Developmental Biology 2024Quote: ... spermatozoa were released into 500 μL of preincubated human tubal fluid medium (HTF: Millipore, Merck KGaA, Darmstadt, Germany) for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... cover slips were incubated with the primary antibody (SV40 T antigen mouse-anti-human, Merck-Millipore, 1:50) overnight at 4 °C in a humidifier chamber ...
-
bioRxiv - Cell Biology 2023Quote: Glass bottom well plates (Celvis) were coated with 5 µg/ml of human plasma fibronectin purified protein (Merck) for one hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: Glass bottom well plates (Celvis) were coated with 5 µg/ml of human plasma fibronectin purified protein (Merck) for one hour at room temperature ...
-
bioRxiv - Genomics 2023Quote: Luminex assays were performed using the Milliplex Human Cytokine/Chemokine Magnetic Bead Panel (HCYTOMAG-60K-41, Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... spermatozoa from JF1/MsJ males were capacitated in Human Tubal Fluid medium (Merck Millipore, Cat#MR-070-D) supplemented with 10 mg ml−1 Albumin (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Cells were cultured for 14 days in RPMI 1640 (ccpro) supplemented with 10 % heat-inactivated human serum (Merck), 10 ng/ml IL-7 ...
-
bioRxiv - Pathology 2024Quote: ... after a 2 hours fasting period followed by an intraperitoneal (i.p.) injection of human insulin (0.75 U.kg-1 of body weight; I9278, Merck, Germany), glycaemia was measured in the same way as for the OGTT.
-
bioRxiv - Physiology 2020Quote: ... Insulin concentration was determined using the MILLIPLEX® MAP Human Metabolic Hormone Magnetic Bead Panel (Merck KGaA, Darmstadt, Germany) according to the manufacturer s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... Purified human integrin α5β1 and anti-α5 (MAB1956Z) and anti-α5β1 (MAB1999) antibodies were from Merck (Kenilworth, NJ, USA). Volociximab was from Novus Biologicals (Littleton ...
-
bioRxiv - Cell Biology 2021Quote: The digoxigenin-labeled antisense probe targeting bases 32-500 of human GNRH1 mRNA (NM_001083111.2) was transcribed in the presence of digoxigenin-11-UTP (Merck Millipore) in a reaction mixture containing linearized cDNA template (1 µg) ...
-
bioRxiv - Biochemistry 2020Quote: ... was equilibrated with increasing concentrations of NAb (30 pM–1.0 µM) in the presence of 90% heat-inactivated human serum (H5667, Merck) at a temperature of 4 °C overnight ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with unlabeled SARS-CoV-2 spike S1 at increasing concentrations (100 pM–3.2 µM) in the presence of 90% heat-inactivated human serum (H5667, Merck) and incubated at 4 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... CD3+ T cells were cultured in TexMACS Medium (Miltenyi Biotech) supplemented with 5% heat-inactivated human AB serum (Merck), 100 units/mL penicillin (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... and primers anchored in the homology arms of the HDRT specific for KI at the human TRAC locus (Merck). PCR amplicons (typically 2.5 mL ...
-
bioRxiv - Cell Biology 2023Quote: 293T human embryo kidney (HEK293T) cells were grown in Dulbecco’s modified Eagle’s medium (4.5 g/l glucose) (Merck, Dorset, UK) enriched with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2024Quote: Plasma cytokine/chemokine levels were measured using the Human Th17 Magnetic Bead Panel (TH17MAG-14kMILLIPLEX MAP, Merck; Darmstadt, Germany) allowing the simultaneous quantification of the following cytokines ...
-
bioRxiv - Cell Biology 2024Quote: The CAF domain (residues 148-223) of human PMEL was subcloned into the pET24a plasmid (Merck Millipore, Darmstadt, Germany) and transformed into E ...
-
bioRxiv - Microbiology 2021Quote: ... PBMCs (2 × 106 cells) were plated onto 48-well plates (NalgeNunc) in RPMI-1640 with 5% inactivated male human AB serum (Merck) for 3 hours ...
-
bioRxiv - Immunology 2021Quote: ... that serves as support for the culture system was prepared seeding human dermal fibroblasts (200,000) re-suspended in a fibrin gel made of fibrinogen (Merck-Millipore), thrombin (Merck-Millipore ...
-
CRISPR-SID: identifying EZH2 as a druggable target for desmoid tumors via in vivo dependency mappingbioRxiv - Cancer Biology 2021Quote: Wild-type Xenopus tropicalis females and males were primed with 20U and 10U PREGNYL© human chorionic gonadotropine (hCG) (Merck), respectively ...
-
bioRxiv - Developmental Biology 2022Quote: Ovulation was induced by injecting adult female Xenopus laevis with 600 units of human chorionic gonadotropin (HCG, MERCK Animal Health) and animals were kept at 16 dc overnight ...
-
bioRxiv - Bioengineering 2021Quote: Isolation of fresh human PBMCs was initiated within 1 h after blood collection using Histopaque® 1077 (10771; Merck KGaA) and standard density centrifugation (800 rcf ...
-
bioRxiv - Bioengineering 2021Quote: The rat INS-1 832/3 cell line (insulinoma cell line stably transfected with human insulin; hereinafter INS-1) was obtained from Merck. A HUVEC (human umbilical vein endothelial cell ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Aliquots of our working standard were generated by spiking 50 μL of our generated VLPs into 950 μL of human plasma (Merck). The calibration curve samples and the aliquots of working standard were then tested using a cobas® 6800 system (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: ... 500 μg/mL rice-derived recombinant human albumin and 213 μg/mL L-ascorbic acid 2-phosphate (both from Merck). After 24 h of CHIR99021 stimulation ...
-
bioRxiv - Biophysics 2021Quote: ... This mix included 98% unlabeled recombinant human E254N tubulin diluted in assay buffer containing oxygen scavengers (180 mg/ml catalase (C40, Merck) and 752 mg/ml glucose oxidase (22778.01 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Another washing step was conducted as before and the Anti-Human IgE (ε-chain specific) detecting antibody (Merck, Darmstadt, Germany) was diluted 1:1000 (v/v ...